EMAIL THIS PAGE TO A FRIEND

SYVN1

synovial apoptosis inhibitor 1, synoviolin

Synonyms: DER3 HRD1
UniProtKB ID: Q86TM6, Q8N3K3, Q8N6E8, Q96JL5, Q96PK3
Gene ID:
Human(84447) Summary: This gene encodes a protein involved in endoplasmic reticulum (ER)-associated degradation. The encoded protein removes unfolded proteins, accumulated during ER stress, by retrograde transport to the cytosol from the ER. This protein also uses the ubiquitin-proteasome system for additional degradation of unfolded proteins. Sequence analysis identified two transcript variants that encode different isoforms. [provided by RefSeq, May 2011]
Mouse(74126) synovial apoptosis inhibitor 1, synoviolin
Rat(361712) synovial apoptosis inhibitor 1, synoviolin
cow(508358) synovial apoptosis inhibitor 1, synoviolin
sheep(101121218) synovial apoptosis inhibitor 1, synoviolin
naked mole-rat(101697993) synovial apoptosis inhibitor 1, synoviolin
domestic guinea pig(100722976) synovial apoptosis inhibitor 1, synoviolin
Zebrafish(335226) synovial apoptosis inhibitor 1, synoviolin
Horse(100050962) synovial apoptosis inhibitor 1, synoviolin
domestic cat(101084316) synovial apoptosis inhibitor 1, synoviolin
dog(483746) synovial apoptosis inhibitor 1, synoviolin
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305977 ANTI-HRD1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
H7915 Anti-HRD1/SYVN1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
H7790 Anti-HRD1/SYVN1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunoprecipitation, western blot pricing
S8949 Anti-SYVN1 (121-133) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
S9074 Anti-SYVN1 (491-503) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV43361 Anti-SYVN1 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse, human, rat
western blot pricing
AV43360 Anti-SYVN1 (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, canine, horse, mouse, bovine, guinea pig, human, rat
western blot pricing
HPA005480 Anti-SYVN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA024300 Anti-SYVN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4200423 Monoclonal Anti-HRD1/SYVN1 antibody produced in mouse ~1.0 mg/mL, clone HRD1-5, purified immunoglobulin human
immunoprecipitation, western blot pricing
SAB1402641 Monoclonal Anti-SYVN1 antibody produced in mouse clone 4H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032431 Rosetta Predictions human pricing
NM_172230 Rosetta Predictions human pricing
NM_001100739 Rosetta Predictions rat pricing
NM_028769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064900 predicted 763
2 SASI_Hs01_00064901 predicted 774
3 SASI_Hs01_00064902 predicted 506
4 SASI_Hs01_00064903 predicted 348
5 SASI_Hs02_00359836 predicted 709
6 SASI_Hs01_00064904 predicted 906
7 SASI_Hs01_00064905 predicted 288
8 SASI_Hs01_00064906 predicted 895
9 SASI_Hs01_00064907 predicted 625
10 SASI_Hs01_00064908 predicted 848
11 SASI_Hs01_00064909 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209646 predicted 762
2 SASI_Hs01_00209647 predicted 776
3 SASI_Hs01_00209648 predicted 505
4 SASI_Hs01_00209649 predicted 352
5 SASI_Hs02_00367939 predicted 701
6 SASI_Hs01_00209650 predicted 902
7 SASI_Hs01_00209651 predicted 291
8 SASI_Hs01_00209652 predicted 895
9 SASI_Hs01_00209653 predicted 626
10 SASI_Hs01_00209654 predicted 849
11 SASI_Hs01_00209655 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210428 predicted 771
2 SASI_Rn02_00210429 predicted 811
3 SASI_Rn02_00210430 predicted 551
4 SASI_Rn02_00210431 predicted 406
5 SASI_Rn02_00210432 predicted 515
6 SASI_Rn02_00210433 predicted 711
7 SASI_Rn02_00210434 predicted 790
8 SASI_Rn02_00210435 predicted 758
9 SASI_Rn02_00210436 predicted 2002
10 SASI_Rn02_00210437 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111463 predicted 731
2 SASI_Mm01_00111464 predicted 1029
3 SASI_Mm01_00111465 predicted 1396
4 SASI_Mm01_00111466 predicted 542
5 SASI_Mm01_00111467 predicted 1090
6 SASI_Mm01_00111468 predicted 1020
7 SASI_Mm01_00111470 predicted 1366
8 SASI_Mm01_00111471 predicted 1286
9 SASI_Mm01_00111472 predicted 1340
10 SASI_Mm02_00334368 predicted 1111
11 SASI_Mm01_00111469 predicted 751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032431
VALIDATED
SYVN1 MISSION shRNA Bacterial Glycerol Stock
synovial apoptosis inhibitor 1, synoviolin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032431.1-2804s1c1
Sequence:CCGGTGAATGCTTAATCCCGGGAAACTCGAGTTTCCCGGGATTAAGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032431.1-458s1c1
Sequence:CCGGGACCGTGTGGACTTTATGGAACTCGAGTTCCATAAAGTCCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032431.1-152s1c1
Sequence:CCGGGCTCACGCCTACTACCTCAAACTCGAGTTTGAGGTAGTAGGCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-273s21c1
Sequence:CCGGTGATGGGCAAGGTGTTCTTTGCTCGAGCAAAGAACACCTTGCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-2305s21c1
Sequence:CCGGACTGCAGTGCCGAACAGTATTCTCGAGAATACTGTTCGGCACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-651s21c1
Sequence:CCGGTCACCATCTTCATCAAGTATGCTCGAGCATACTTGATGAAGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-942s21c1
Sequence:CCGGAGCTCCAGGCAATGGACAATGCTCGAGCATTGTCCATTGCCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-903s21c1
Sequence:CCGGGCAACATGAACACCCTGTATCCTCGAGGATACAGGGTGTTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-2273s21c1
Sequence:CCGGCCTCCAAGCCCTACTTGTATGCTCGAGCATACAAGTAGGGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-486s21c1
Sequence:CCGGCCAACATCTCCTGGCTCTTTCCTCGAGGAAAGAGCCAGGAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032431
VALIDATED
SYVN1 MISSION shRNA shRNA Plasmid DNA
synovial apoptosis inhibitor 1, synoviolin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032431.1-2804s1c1
Sequence:CCGGTGAATGCTTAATCCCGGGAAACTCGAGTTTCCCGGGATTAAGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032431.1-458s1c1
Sequence:CCGGGACCGTGTGGACTTTATGGAACTCGAGTTCCATAAAGTCCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032431.1-152s1c1
Sequence:CCGGGCTCACGCCTACTACCTCAAACTCGAGTTTGAGGTAGTAGGCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-273s21c1
Sequence:CCGGTGATGGGCAAGGTGTTCTTTGCTCGAGCAAAGAACACCTTGCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-2305s21c1
Sequence:CCGGACTGCAGTGCCGAACAGTATTCTCGAGAATACTGTTCGGCACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-651s21c1
Sequence:CCGGTCACCATCTTCATCAAGTATGCTCGAGCATACTTGATGAAGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-942s21c1
Sequence:CCGGAGCTCCAGGCAATGGACAATGCTCGAGCATTGTCCATTGCCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-903s21c1
Sequence:CCGGGCAACATGAACACCCTGTATCCTCGAGGATACAGGGTGTTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-2273s21c1
Sequence:CCGGCCTCCAAGCCCTACTTGTATGCTCGAGCATACAAGTAGGGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-486s21c1
Sequence:CCGGCCAACATCTCCTGGCTCTTTCCTCGAGGAAAGAGCCAGGAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032431
VALIDATED
SYVN1 MISSION shRNA Lentiviral Transduction Particles
synovial apoptosis inhibitor 1, synoviolin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032431.1-2804s1c1
Sequence:CCGGTGAATGCTTAATCCCGGGAAACTCGAGTTTCCCGGGATTAAGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032431.1-458s1c1
Sequence:CCGGGACCGTGTGGACTTTATGGAACTCGAGTTCCATAAAGTCCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032431.1-152s1c1
Sequence:CCGGGCTCACGCCTACTACCTCAAACTCGAGTTTGAGGTAGTAGGCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-273s21c1
Sequence:CCGGTGATGGGCAAGGTGTTCTTTGCTCGAGCAAAGAACACCTTGCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-2305s21c1
Sequence:CCGGACTGCAGTGCCGAACAGTATTCTCGAGAATACTGTTCGGCACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-651s21c1
Sequence:CCGGTCACCATCTTCATCAAGTATGCTCGAGCATACTTGATGAAGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-942s21c1
Sequence:CCGGAGCTCCAGGCAATGGACAATGCTCGAGCATTGTCCATTGCCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-903s21c1
Sequence:CCGGGCAACATGAACACCCTGTATCCTCGAGGATACAGGGTGTTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032431.2-2273s21c1
Sequence:CCGGCCTCCAAGCCCTACTTGTATGCTCGAGCATACAAGTAGGGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032431.2-486s21c1
Sequence:CCGGCCAACATCTCCTGGCTCTTTCCTCGAGGAAAGAGCCAGGAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028769
VALIDATED
SYVN1 MISSION shRNA Bacterial Glycerol Stock
synovial apoptosis inhibitor 1, synoviolin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-2569s1c1
Sequence:CCGGGCCTTCAAAGTAGAAGCTGAACTCGAGTTCAGCTTCTACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-997s1c1
Sequence:CCGGGCTGGTATTTGGCTTTGAGTACTCGAGTACTCAAAGCCAAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-2183s1c1
Sequence:CCGGCCACCAATTCCTGAAGCAGAACTCGAGTTCTGCTTCAGGAATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028769.4-1291s1c1
Sequence:CCGGCCGCAACATGAACACACTGTACTCGAGTACAGTGTGTTCATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028769.4-820s1c1
Sequence:CCGGCCTCAAATGTTTCCATTGGTTCTCGAGAACCAATGGAAACATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028769.4-997s21c1
Sequence:CCGGGCTGGTATTTGGCTTTGAGTACTCGAGTACTCAAAGCCAAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028769.4-2569s21c1
Sequence:CCGGGCCTTCAAAGTAGAAGCTGAACTCGAGTTCAGCTTCTACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028769.4-1291s21c1
Sequence:CCGGCCGCAACATGAACACACTGTACTCGAGTACAGTGTGTTCATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028769.4-2183s21c1
Sequence:CCGGCCACCAATTCCTGAAGCAGAACTCGAGTTCTGCTTCAGGAATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028769.4-945s21c1
Sequence:CCGGTCTTCGTCAGCCACGCTTATCCTCGAGGATAAGCGTGGCTGACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028769
VALIDATED
SYVN1 MISSION shRNA shRNA Plasmid DNA
synovial apoptosis inhibitor 1, synoviolin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-2569s1c1
Sequence:CCGGGCCTTCAAAGTAGAAGCTGAACTCGAGTTCAGCTTCTACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-997s1c1
Sequence:CCGGGCTGGTATTTGGCTTTGAGTACTCGAGTACTCAAAGCCAAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-2183s1c1
Sequence:CCGGCCACCAATTCCTGAAGCAGAACTCGAGTTCTGCTTCAGGAATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028769.4-1291s1c1
Sequence:CCGGCCGCAACATGAACACACTGTACTCGAGTACAGTGTGTTCATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028769.4-820s1c1
Sequence:CCGGCCTCAAATGTTTCCATTGGTTCTCGAGAACCAATGGAAACATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028769.4-997s21c1
Sequence:CCGGGCTGGTATTTGGCTTTGAGTACTCGAGTACTCAAAGCCAAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028769.4-2569s21c1
Sequence:CCGGGCCTTCAAAGTAGAAGCTGAACTCGAGTTCAGCTTCTACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028769.4-1291s21c1
Sequence:CCGGCCGCAACATGAACACACTGTACTCGAGTACAGTGTGTTCATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028769.4-2183s21c1
Sequence:CCGGCCACCAATTCCTGAAGCAGAACTCGAGTTCTGCTTCAGGAATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028769.4-945s21c1
Sequence:CCGGTCTTCGTCAGCCACGCTTATCCTCGAGGATAAGCGTGGCTGACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028769
VALIDATED
SYVN1 MISSION shRNA Lentiviral Transduction Particles
synovial apoptosis inhibitor 1, synoviolin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-2569s1c1
Sequence:CCGGGCCTTCAAAGTAGAAGCTGAACTCGAGTTCAGCTTCTACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-997s1c1
Sequence:CCGGGCTGGTATTTGGCTTTGAGTACTCGAGTACTCAAAGCCAAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028769.4-2183s1c1
Sequence:CCGGCCACCAATTCCTGAAGCAGAACTCGAGTTCTGCTTCAGGAATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028769.4-1291s1c1
Sequence:CCGGCCGCAACATGAACACACTGTACTCGAGTACAGTGTGTTCATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028769.4-820s1c1
Sequence:CCGGCCTCAAATGTTTCCATTGGTTCTCGAGAACCAATGGAAACATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028769.4-997s21c1
Sequence:CCGGGCTGGTATTTGGCTTTGAGTACTCGAGTACTCAAAGCCAAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028769.4-2569s21c1
Sequence:CCGGGCCTTCAAAGTAGAAGCTGAACTCGAGTTCAGCTTCTACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028769.4-1291s21c1
Sequence:CCGGCCGCAACATGAACACACTGTACTCGAGTACAGTGTGTTCATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028769.4-2183s21c1
Sequence:CCGGCCACCAATTCCTGAAGCAGAACTCGAGTTCTGCTTCAGGAATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028769.4-945s21c1
Sequence:CCGGTCTTCGTCAGCCACGCTTATCCTCGAGGATAAGCGTGGCTGACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks