EMAIL THIS PAGE TO A FRIEND

SZRD1

SUZ RNA binding domain containing 1

Synonyms: C1orf144
UniProtKB ID: Q7Z422, A8MXJ2, Q7Z424, Q8IVM2, Q8TBV3, Q9Y403
Gene ID:
Mouse(213491) SUZ RNA binding domain containing 1
Rat(500575) SUZ RNA binding domain containing 1
Zebrafish(554231) SUZ RNA binding domain containing 1
domestic cat(101083691) SUZ RNA binding domain containing 1
dog(608518) SUZ RNA binding domain containing 1
cow(512452) SUZ RNA binding domain containing 1
domestic guinea pig(100730192) SUZ RNA binding domain containing 1
naked mole-rat(101716618) SUZ RNA binding domain containing 1
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114600 Rosetta Predictions human pricing
NM_015609 Rosetta Predictions human pricing
NM_001100798 Rosetta Predictions rat pricing
NM_001114599 Rosetta Predictions rat pricing
NM_001025608 Rosetta Predictions mouse pricing
NM_174996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326644 predicted 820
2 SASI_Hs02_00326645 predicted 849
3 SASI_Hs02_00326646 predicted 333
4 SASI_Hs02_00326647 predicted 1038
5 SASI_Hs02_00326648 predicted 529
6 SASI_Hs02_00326649 predicted 1043
7 SASI_Hs02_00326650 predicted 412
8 SASI_Hs02_00326651 predicted 838
9 SASI_Hs02_00326652 predicted 531
10 SASI_Hs02_00326653 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244016 predicted 778
2 SASI_Hs01_00244007 predicted 806
3 SASI_Hs01_00244013 predicted 292
4 SASI_Hs02_00348204 predicted 368
5 SASI_Hs02_00348205 predicted 788
6 SASI_Hs01_00244008 predicted 512
7 SASI_Hs02_00348206 predicted 205
8 SASI_Hs01_00244015 predicted 238
9 SASI_Hs01_00244009 predicted 670
10 SASI_Hs02_00348207 predicted 987
11 SASI_Hs01_00244010 predicted 425
12 SASI_Hs01_00244011 predicted 547
13 SASI_Hs01_00244012 predicted 437
14 SASI_Hs01_00244014 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210572 predicted 524
2 SASI_Rn02_00210573 predicted 535
3 SASI_Rn02_00210574 predicted 395
4 SASI_Rn02_00210575 predicted 400
5 SASI_Rn02_00210576 predicted 625
6 SASI_Rn02_00210577 predicted 342
7 SASI_Rn02_00210578 predicted 71
8 SASI_Rn02_00210579 predicted 88
9 SASI_Rn02_00210580 predicted 789
10 SASI_Rn02_00210581 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252283 predicted 574
2 SASI_Rn02_00252284 predicted 589
3 SASI_Rn02_00252285 predicted 446
4 SASI_Rn02_00252286 predicted 442
5 SASI_Rn02_00252287 predicted 673
6 SASI_Rn02_00252288 predicted 389
7 SASI_Rn02_00252289 predicted 125
8 SASI_Rn02_00252290 predicted 139
9 SASI_Rn02_00252291 predicted 840
10 SASI_Rn02_00252292 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076652 predicted 618
2 SASI_Mm01_00076651 predicted 607
3 SASI_Mm01_00076654 predicted 163
4 SASI_Mm01_00076655 predicted 218
5 SASI_Mm02_00287975 predicted 876
6 SASI_Mm01_00076656 predicted 178
7 SASI_Mm01_00076658 predicted 184
8 SASI_Mm02_00287976 predicted 918
9 SASI_Mm01_00076660 predicted 920
10 SASI_Mm02_00287977 predicted 864
11 SASI_Mm01_00076653 predicted 504
12 SASI_Mm01_00076657 predicted 596
13 SASI_Mm01_00076659 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062556 predicted 570
2 SASI_Mm01_00062555 predicted 560
3 SASI_Mm01_00062558 predicted 113
4 SASI_Mm02_00345536 predicted 170
5 SASI_Mm02_00345537 predicted 826
6 SASI_Mm01_00062559 predicted 131
7 SASI_Mm01_00062561 predicted 125
8 SASI_Mm02_00345538 predicted 867
9 SASI_Mm01_00062563 predicted 870
10 SASI_Mm01_00062564 predicted 817
11 SASI_Mm01_00062557 predicted 461
12 SASI_Mm01_00062560 predicted 542
13 SASI_Mm01_00062562 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015609
VALIDATED
SZRD1 MISSION shRNA Bacterial Glycerol Stock
SUZ RNA binding domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-807s21c1
Sequence:CCGGCCAAGTCAATGGAAAGGGAAACTCGAGTTTCCCTTTCCATTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-1479s21c1
Sequence:CCGGCCAGGCTTACTACTTCTAGAACTCGAGTTCTAGAAGTAGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015609.3-507s21c1
Sequence:CCGGCAGGCAGCCCAATAATGTGATCTCGAGATCACATTATTGGGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-250s21c1
Sequence:CCGGCCCATTGTGATTCAGGACGATCTCGAGATCGTCCTGAATCACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-104s1c1
Sequence:CCGGCCCAAAGTGCCCATTGTGATTCTCGAGAATCACAATGGGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-1346s1c1
Sequence:CCGGGCTTACTACTTCTAGAAGAAACTCGAGTTTCTTCTAGAAGTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-670s1c1
Sequence:CCGGCCAAGTCAATGGAAAGGGAAACTCGAGTTTCCCTTTCCATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-1342s1c1
Sequence:CCGGCCAGGCTTACTACTTCTAGAACTCGAGTTCTAGAAGTAGTAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015609.1-1498s1c1
Sequence:CCGGCGTATGTTCAGAAGGTGGATACTCGAGTATCCACCTTCTGAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-119s1c1
Sequence:CCGGGTGATTCAGGACGATAGCCTTCTCGAGAAGGCTATCGTCCTGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-113s1c1
Sequence:CCGGCCCATTGTGATTCAGGACGATCTCGAGATCGTCCTGAATCACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-370s1c1
Sequence:CCGGCAGGCAGCCCAATAATGTGATCTCGAGATCACATTATTGGGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-669s1c1
Sequence:CCGGCCCAAGTCAATGGAAAGGGAACTCGAGTTCCCTTTCCATTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015609
VALIDATED
SZRD1 MISSION shRNA shRNA Plasmid DNA
SUZ RNA binding domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-807s21c1
Sequence:CCGGCCAAGTCAATGGAAAGGGAAACTCGAGTTTCCCTTTCCATTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-1479s21c1
Sequence:CCGGCCAGGCTTACTACTTCTAGAACTCGAGTTCTAGAAGTAGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015609.3-507s21c1
Sequence:CCGGCAGGCAGCCCAATAATGTGATCTCGAGATCACATTATTGGGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-250s21c1
Sequence:CCGGCCCATTGTGATTCAGGACGATCTCGAGATCGTCCTGAATCACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-104s1c1
Sequence:CCGGCCCAAAGTGCCCATTGTGATTCTCGAGAATCACAATGGGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-1346s1c1
Sequence:CCGGGCTTACTACTTCTAGAAGAAACTCGAGTTTCTTCTAGAAGTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-670s1c1
Sequence:CCGGCCAAGTCAATGGAAAGGGAAACTCGAGTTTCCCTTTCCATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-1342s1c1
Sequence:CCGGCCAGGCTTACTACTTCTAGAACTCGAGTTCTAGAAGTAGTAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015609.1-1498s1c1
Sequence:CCGGCGTATGTTCAGAAGGTGGATACTCGAGTATCCACCTTCTGAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-119s1c1
Sequence:CCGGGTGATTCAGGACGATAGCCTTCTCGAGAAGGCTATCGTCCTGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-113s1c1
Sequence:CCGGCCCATTGTGATTCAGGACGATCTCGAGATCGTCCTGAATCACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-370s1c1
Sequence:CCGGCAGGCAGCCCAATAATGTGATCTCGAGATCACATTATTGGGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-669s1c1
Sequence:CCGGCCCAAGTCAATGGAAAGGGAACTCGAGTTCCCTTTCCATTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015609
VALIDATED
SZRD1 MISSION shRNA Lentiviral Transduction Particles
SUZ RNA binding domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-807s21c1
Sequence:CCGGCCAAGTCAATGGAAAGGGAAACTCGAGTTTCCCTTTCCATTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-1479s21c1
Sequence:CCGGCCAGGCTTACTACTTCTAGAACTCGAGTTCTAGAAGTAGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015609.3-507s21c1
Sequence:CCGGCAGGCAGCCCAATAATGTGATCTCGAGATCACATTATTGGGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015609.3-250s21c1
Sequence:CCGGCCCATTGTGATTCAGGACGATCTCGAGATCGTCCTGAATCACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-104s1c1
Sequence:CCGGCCCAAAGTGCCCATTGTGATTCTCGAGAATCACAATGGGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-1346s1c1
Sequence:CCGGGCTTACTACTTCTAGAAGAAACTCGAGTTTCTTCTAGAAGTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-670s1c1
Sequence:CCGGCCAAGTCAATGGAAAGGGAAACTCGAGTTTCCCTTTCCATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-1342s1c1
Sequence:CCGGCCAGGCTTACTACTTCTAGAACTCGAGTTCTAGAAGTAGTAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015609.1-1498s1c1
Sequence:CCGGCGTATGTTCAGAAGGTGGATACTCGAGTATCCACCTTCTGAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-119s1c1
Sequence:CCGGGTGATTCAGGACGATAGCCTTCTCGAGAAGGCTATCGTCCTGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-113s1c1
Sequence:CCGGCCCATTGTGATTCAGGACGATCTCGAGATCGTCCTGAATCACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-370s1c1
Sequence:CCGGCAGGCAGCCCAATAATGTGATCTCGAGATCACATTATTGGGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015609.1-669s1c1
Sequence:CCGGCCCAAGTCAATGGAAAGGGAACTCGAGTTCCCTTTCCATTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174996
VALIDATED
SZRD1 MISSION shRNA Bacterial Glycerol Stock
SUZ RNA binding domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-396s21c1
Sequence:CCGGAGCCCAGCAATGTGATCAGACCTCGAGGTCTGATCACATTGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-1017s21c1
Sequence:CCGGTAATTGAGAAAGGGTAGTTTACTCGAGTAAACTACCCTTTCTCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-443s21c1
Sequence:CCGGGGCTTCAAACAGCGCAGATAACTCGAGTTATCTGCGCTGTTTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-175s21c1
Sequence:CCGGTCCACAGATCCGCATCCTCAACTCGAGTTGAGGATGCGGATCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-126s21c1
Sequence:CCGGCCAAAGTGCCCATTGTGATTCCTCGAGGAATCACAATGGGCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-518s1c1
Sequence:CCGGGCAGAGGGAATAACCTGACTTCTCGAGAAGTCAGGTTATTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192562    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-643s1c1
Sequence:CCGGGCTGTCCCAAGTCAATAGAAACTCGAGTTTCTATTGACTTGGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-519s1c1
Sequence:CCGGCAGAGGGAATAACCTGACTTACTCGAGTAAGTCAGGTTATTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174996
VALIDATED
SZRD1 MISSION shRNA shRNA Plasmid DNA
SUZ RNA binding domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-396s21c1
Sequence:CCGGAGCCCAGCAATGTGATCAGACCTCGAGGTCTGATCACATTGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-1017s21c1
Sequence:CCGGTAATTGAGAAAGGGTAGTTTACTCGAGTAAACTACCCTTTCTCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-443s21c1
Sequence:CCGGGGCTTCAAACAGCGCAGATAACTCGAGTTATCTGCGCTGTTTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-175s21c1
Sequence:CCGGTCCACAGATCCGCATCCTCAACTCGAGTTGAGGATGCGGATCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-126s21c1
Sequence:CCGGCCAAAGTGCCCATTGTGATTCCTCGAGGAATCACAATGGGCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-518s1c1
Sequence:CCGGGCAGAGGGAATAACCTGACTTCTCGAGAAGTCAGGTTATTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192562    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-643s1c1
Sequence:CCGGGCTGTCCCAAGTCAATAGAAACTCGAGTTTCTATTGACTTGGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-519s1c1
Sequence:CCGGCAGAGGGAATAACCTGACTTACTCGAGTAAGTCAGGTTATTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174996
VALIDATED
SZRD1 MISSION shRNA Lentiviral Transduction Particles
SUZ RNA binding domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-396s21c1
Sequence:CCGGAGCCCAGCAATGTGATCAGACCTCGAGGTCTGATCACATTGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-1017s21c1
Sequence:CCGGTAATTGAGAAAGGGTAGTTTACTCGAGTAAACTACCCTTTCTCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-443s21c1
Sequence:CCGGGGCTTCAAACAGCGCAGATAACTCGAGTTATCTGCGCTGTTTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-175s21c1
Sequence:CCGGTCCACAGATCCGCATCCTCAACTCGAGTTGAGGATGCGGATCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174996.2-126s21c1
Sequence:CCGGCCAAAGTGCCCATTGTGATTCCTCGAGGAATCACAATGGGCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-518s1c1
Sequence:CCGGGCAGAGGGAATAACCTGACTTCTCGAGAAGTCAGGTTATTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192562    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-643s1c1
Sequence:CCGGGCTGTCCCAAGTCAATAGAAACTCGAGTTTCTATTGACTTGGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174996.1-519s1c1
Sequence:CCGGCAGAGGGAATAACCTGACTTACTCGAGTAAGTCAGGTTATTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks