EMAIL THIS PAGE TO A FRIEND

SZT2

seizure threshold 2 homolog (mouse)

Synonyms: C1orf84 KIAA0467 RP11-506B15.3 SZT2A SZT2B
Gene ID:
Human(23334) Summary: The protein encoded by this gene is expressed in the brain, predominantly in the parietal and frontal cortex as well as in dorsal root ganglia. It is localized to the peroxisome, and is implicated in resistance to oxidative stress. It likely functions by increasing superoxide dismutase (SOD) activity, but itself has no direct SOD activity. Studies in mice show that this gene confers low seizure threshold, and may also enhance epileptogenesis. [provided by RefSeq, Jun 2011]
Mouse(230676) seizure threshold 2
Rat(362573) seizure threshold 2 homolog (mouse)
cow(533805) seizure threshold 2 homolog (mouse)
sheep(101107405) seizure threshold 2 homolog (mouse)
naked mole-rat(101708316) seizure threshold 2 homolog (mouse)
domestic guinea pig(100719376) seizure threshold 2 homolog (mouse)
chicken(424566) seizure threshold 2 homolog (mouse)
domestic cat(101098316) seizure threshold 2 homolog (mouse)
Horse(100066517) seizure threshold 2 homolog (mouse)
dog(482532) seizure threshold 2 homolog (mouse)
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015284 Rosetta Predictions human pricing
XM_001069457 Rosetta Predictions rat pricing
XM_342892 Rosetta Predictions rat pricing
NM_198170 Rosetta Predictions mouse pricing
XM_001477657 Rosetta Predictions mouse pricing
XM_001481275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025295 predicted 7859
2 SASI_Hs02_00347467 predicted 2380
3 SASI_Hs01_00025298 predicted 4593
4 SASI_Hs01_00025299 predicted 3399
5 SASI_Hs02_00347468 predicted 3862
6 SASI_Hs01_00025300 predicted 5347
7 SASI_Hs01_00025301 predicted 5147
8 SASI_Hs01_00025302 predicted 6140
9 SASI_Hs01_00025303 predicted 1727
10 SASI_Hs01_00025304 predicted 720
11 SASI_Hs01_00025296 predicted 4587
12 SASI_Hs01_00025297 predicted 7107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328147 predicted 3050
2 SASI_Rn02_00328148 predicted 2135
3 SASI_Rn02_00328149 predicted 4495
4 SASI_Rn02_00328150 predicted 5268
5 SASI_Rn02_00328151 predicted 429
6 SASI_Rn02_00328152 predicted 7631
7 SASI_Rn02_00328153 predicted 240
8 SASI_Rn02_00328154 predicted 6663
9 SASI_Rn02_00328155 predicted 625
10 SASI_Rn02_00328156 predicted 3045
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394971 predicted 749
2 SASI_Rn02_00394972 predicted 5650
3 SASI_Rn02_00394973 predicted 2564
4 SASI_Rn02_00394974 predicted 7097
5 SASI_Rn02_00394975 predicted 7865
6 SASI_Rn02_00394976 predicted 3059
7 SASI_Rn02_00394977 predicted 1456
8 SASI_Rn02_00394978 predicted 1795
9 SASI_Rn02_00394979 predicted 2876
10 SASI_Rn02_00394980 predicted 9260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172014 predicted 2962
2 SASI_Mm01_00172015 predicted 676
3 SASI_Mm01_00172016 predicted 1760
4 SASI_Mm01_00172017 predicted 2649
5 SASI_Mm01_00172018 predicted 372
6 SASI_Mm01_00172019 predicted 2094
7 SASI_Mm01_00172020 predicted 2964
8 SASI_Mm01_00172021 predicted 2748
9 SASI_Mm01_00172022 predicted 774
10 SASI_Mm01_00172023 predicted 2755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00397299 predicted 8745
2 SASI_Mm02_00397300 predicted 8653
3 SASI_Mm02_00397301 predicted 9202
4 SASI_Mm02_00397302 predicted 9976
5 SASI_Mm02_00397303 predicted 8761
6 SASI_Mm02_00397304 predicted 7926
7 SASI_Mm02_00397305 predicted 9658
8 SASI_Mm02_00397306 predicted 9099
9 SASI_Mm02_00397307 predicted 9969
10 SASI_Mm02_00397308 predicted 9753
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423326 predicted 765
2 SASI_Mm02_00423327 predicted 9923
3 SASI_Mm02_00423328 predicted 4436
4 SASI_Mm02_00423329 predicted 3838
5 SASI_Mm02_00423330 predicted 1440
6 SASI_Mm02_00423331 predicted 2914
7 SASI_Mm02_00423332 predicted 9054
8 SASI_Mm02_00423333 predicted 7728
9 SASI_Mm02_00423334 predicted 6814
10 SASI_Mm02_00423335 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015284
SZT2 MISSION shRNA Bacterial Glycerol Stock
seizure threshold 2 homolog (mouse)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015284.1-2569s1c1
Sequence:CCGGGACTTGGACATCTACTTGTATCTCGAGATACAAGTAGATGTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-3352s21c1
Sequence:CCGGGACTCAGACCACCTAGGTTATCTCGAGATAACCTAGGTGGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-2790s21c1
Sequence:CCGGGCACCCAGGACTATCCAATTTCTCGAGAAATTGGATAGTCCTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015284.2-9418s21c1
Sequence:CCGGTAAGATGGCTGCCGCTGTAAGCTCGAGCTTACAGCGGCAGCCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-1671s21c1
Sequence:CCGGGTGCTATGTCCGTGGGCTATTCTCGAGAATAGCCCACGGACATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-788s21c1
Sequence:CCGGTGAGCTTTGAATACCTGATACCTCGAGGTATCAGGTATTCAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015284
SZT2 MISSION shRNA shRNA Plasmid DNA
seizure threshold 2 homolog (mouse)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015284.1-2569s1c1
Sequence:CCGGGACTTGGACATCTACTTGTATCTCGAGATACAAGTAGATGTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-3352s21c1
Sequence:CCGGGACTCAGACCACCTAGGTTATCTCGAGATAACCTAGGTGGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-2790s21c1
Sequence:CCGGGCACCCAGGACTATCCAATTTCTCGAGAAATTGGATAGTCCTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015284.2-9418s21c1
Sequence:CCGGTAAGATGGCTGCCGCTGTAAGCTCGAGCTTACAGCGGCAGCCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-1671s21c1
Sequence:CCGGGTGCTATGTCCGTGGGCTATTCTCGAGAATAGCCCACGGACATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-788s21c1
Sequence:CCGGTGAGCTTTGAATACCTGATACCTCGAGGTATCAGGTATTCAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015284
SZT2 MISSION shRNA Lentiviral Transduction Particles
seizure threshold 2 homolog (mouse)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015284.1-2569s1c1
Sequence:CCGGGACTTGGACATCTACTTGTATCTCGAGATACAAGTAGATGTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-3352s21c1
Sequence:CCGGGACTCAGACCACCTAGGTTATCTCGAGATAACCTAGGTGGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-2790s21c1
Sequence:CCGGGCACCCAGGACTATCCAATTTCTCGAGAAATTGGATAGTCCTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015284.2-9418s21c1
Sequence:CCGGTAAGATGGCTGCCGCTGTAAGCTCGAGCTTACAGCGGCAGCCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-1671s21c1
Sequence:CCGGGTGCTATGTCCGTGGGCTATTCTCGAGAATAGCCCACGGACATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015284.2-788s21c1
Sequence:CCGGTGAGCTTTGAATACCTGATACCTCGAGGTATCAGGTATTCAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198170
VALIDATED
SZT2 MISSION shRNA Bacterial Glycerol Stock
seizure threshold 2 homolog (mouse)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198170.2-598s1c1
Sequence:CCGGGCTAGAGGTTACAGATAAGAACTCGAGTTCTTATCTGTAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198170.2-367s1c1
Sequence:CCGGCCGTGTCTTTGAGCAGCATTTCTCGAGAAATGCTGCTCAAAGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198170.2-1906s1c1
Sequence:CCGGCTTTGGCCGTAATCACATTTACTCGAGTAAATGTGATTACGGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198170.2-3260s1c1
Sequence:CCGGGTTGGACATTACCATTGAGATCTCGAGATCTCAATGGTAATGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-2209s1c1
Sequence:CCGGGCTTCAGTTCTTTGTGGTGCTCTCGAGAGCACCACAAAGAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-1394s1c1
Sequence:CCGGCTGCAGCAATACGTGCAGTATCTCGAGATACTGCACGTATTGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198170.2-2964s1c1
Sequence:CCGGGTTGATTGAATCATGGATCTACTCGAGTAGATCCATGATTCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-1771s1c1
Sequence:CCGGGCACTCCTTCAGCTATGACTTCTCGAGAAGTCATAGCTGAAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198170.3-4296s21c1
Sequence:CCGGTTAGACCCTGGTCCGGAAATTCTCGAGAATTTCCGGACCAGGGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198170.3-10392s21c1
Sequence:CCGGTGATTGAATCATGGATCTATACTCGAGTATAGATCCATGATTCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198170.3-4252s21c1
Sequence:CCGGACCTAAGTGAGCCCGAGTTTCCTCGAGGAAACTCGGGCTCACTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198170
VALIDATED
SZT2 MISSION shRNA shRNA Plasmid DNA
seizure threshold 2 homolog (mouse)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198170.2-598s1c1
Sequence:CCGGGCTAGAGGTTACAGATAAGAACTCGAGTTCTTATCTGTAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198170.2-367s1c1
Sequence:CCGGCCGTGTCTTTGAGCAGCATTTCTCGAGAAATGCTGCTCAAAGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198170.2-1906s1c1
Sequence:CCGGCTTTGGCCGTAATCACATTTACTCGAGTAAATGTGATTACGGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198170.2-3260s1c1
Sequence:CCGGGTTGGACATTACCATTGAGATCTCGAGATCTCAATGGTAATGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-2209s1c1
Sequence:CCGGGCTTCAGTTCTTTGTGGTGCTCTCGAGAGCACCACAAAGAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-1394s1c1
Sequence:CCGGCTGCAGCAATACGTGCAGTATCTCGAGATACTGCACGTATTGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198170.2-2964s1c1
Sequence:CCGGGTTGATTGAATCATGGATCTACTCGAGTAGATCCATGATTCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-1771s1c1
Sequence:CCGGGCACTCCTTCAGCTATGACTTCTCGAGAAGTCATAGCTGAAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198170.3-4296s21c1
Sequence:CCGGTTAGACCCTGGTCCGGAAATTCTCGAGAATTTCCGGACCAGGGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198170.3-10392s21c1
Sequence:CCGGTGATTGAATCATGGATCTATACTCGAGTATAGATCCATGATTCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198170.3-4252s21c1
Sequence:CCGGACCTAAGTGAGCCCGAGTTTCCTCGAGGAAACTCGGGCTCACTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198170
VALIDATED
SZT2 MISSION shRNA Lentiviral Transduction Particles
seizure threshold 2 homolog (mouse)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198170.2-598s1c1
Sequence:CCGGGCTAGAGGTTACAGATAAGAACTCGAGTTCTTATCTGTAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198170.2-367s1c1
Sequence:CCGGCCGTGTCTTTGAGCAGCATTTCTCGAGAAATGCTGCTCAAAGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198170.2-1906s1c1
Sequence:CCGGCTTTGGCCGTAATCACATTTACTCGAGTAAATGTGATTACGGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198170.2-3260s1c1
Sequence:CCGGGTTGGACATTACCATTGAGATCTCGAGATCTCAATGGTAATGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-2209s1c1
Sequence:CCGGGCTTCAGTTCTTTGTGGTGCTCTCGAGAGCACCACAAAGAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-1394s1c1
Sequence:CCGGCTGCAGCAATACGTGCAGTATCTCGAGATACTGCACGTATTGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198170.2-2964s1c1
Sequence:CCGGGTTGATTGAATCATGGATCTACTCGAGTAGATCCATGATTCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198170.2-1771s1c1
Sequence:CCGGGCACTCCTTCAGCTATGACTTCTCGAGAAGTCATAGCTGAAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198170.3-4296s21c1
Sequence:CCGGTTAGACCCTGGTCCGGAAATTCTCGAGAATTTCCGGACCAGGGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198170.3-10392s21c1
Sequence:CCGGTGATTGAATCATGGATCTATACTCGAGTATAGATCCATGATTCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198170.3-4252s21c1
Sequence:CCGGACCTAAGTGAGCCCGAGTTTCCTCGAGGAAACTCGGGCTCACTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks