EMAIL THIS PAGE TO A FRIEND

T

T, brachyury homolog (mouse)

Synonyms: TFT
Species: Human T(6862), Mouse T(20997), Mouse t(20998), Rat T(292301), fruit fly t(31863), domestic cat T(101099211), dog T(403653), chicken T(395782), cow T(524443), sheep T(101114280), domestic guinea pig T(100730715), naked mole-rat T(101710858), Domestic Rabbit T(100008707)
UniProtKB ID: O15178, E7ERD6, Q4KMP4
Gene ID:
Human(6862) Summary: The protein encoded by this gene is an embryonic nuclear transcription factor that binds to a specific DNA element, the palindromic T-site. It binds through a region in its N-terminus, called the T-box, and effects transcription of genes required for mesoderm formation and differentiation. The protein is localized to notochord-derived cells. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(20997) brachyury
Mouse(20998) t-complex
Rat(292301) brachyury
domestic cat(101099211) T, brachyury homolog (mouse)
dog(403653) T, brachyury homolog (mouse)
chicken(395782) T, brachyury homolog (mouse)
cow(524443) T, brachyury homolog (mouse)
sheep(101114280) T, brachyury homolog (mouse)
domestic guinea pig(100730715) T, brachyury homolog (mouse)
naked mole-rat(101710858) T, brachyury homolog (mouse)
Domestic Rabbit(100008707) T, brachyury homolog (mouse)
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B8436 Anti-Brachyury antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB1406503 Anti-T antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412153 ANTI-T antibody produced in mouse clone 5C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412159 ANTI-T antibody produced in mouse clone 5C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412193 ANTI-T antibody produced in mouse clone 5C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412313 ANTI-T antibody produced in mouse clone 5E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412314 ANTI-T antibody produced in mouse clone 6D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412315 ANTI-T antibody produced in mouse clone 5E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412316 ANTI-T antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412317 ANTI-T antibody produced in mouse clone 1H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA003322 Anti-T antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104044 Anti-T antibody produced in rabbit affinity isolated antibody canine, rabbit, human, rabbit, rat, mouse, horse, guinea pig
western blot pricing
WH0006862M2 Monoclonal Anti-T antibody produced in mouse clone 5C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404434 Monoclonal Anti-T antibody produced in mouse clone 5H8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003181 Rosetta Predictions human pricing
NM_001106209 Rosetta Predictions rat pricing
NM_009309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221962 predicted 1714
2 SASI_Hs01_00221964 predicted 1363
3 SASI_Hs01_00221965 predicted 1382
4 SASI_Hs01_00221966 predicted 1373
5 SASI_Hs01_00221967 predicted 1814
6 SASI_Hs01_00221968 predicted 1158
7 SASI_Hs01_00221970 predicted 681
8 SASI_Hs01_00221971 predicted 979
9 SASI_Hs02_00335207 predicted 962
10 SASI_Hs02_00335208 predicted 1073
11 SASI_Hs01_00221963 predicted 1268
12 SASI_Hs01_00221969 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216708 predicted 397
2 SASI_Rn02_00216709 predicted 772
3 SASI_Rn02_00216710 predicted 1412
4 SASI_Rn02_00216711 predicted 605
5 SASI_Rn02_00216712 predicted 985
6 SASI_Rn02_00216713 predicted 709
7 SASI_Rn02_00216714 predicted 525
8 SASI_Rn02_00216715 predicted 886
9 SASI_Rn02_00216716 predicted 299
10 SASI_Rn02_00216717 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315842 predicted 393
2 SASI_Mm01_00155193 predicted 263
3 SASI_Mm01_00155194 predicted 1329
4 SASI_Mm01_00155195 predicted 530
5 SASI_Mm01_00155196 predicted 611
6 SASI_Mm01_00155197 predicted 284
7 SASI_Mm01_00155198 predicted 294
8 SASI_Mm01_00155199 predicted 572
9 SASI_Mm01_00155201 predicted 886
10 SASI_Mm01_00155202 predicted 770
11 SASI_Mm01_00155200 predicted 1420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003181
T MISSION shRNA Bacterial Glycerol Stock
T, brachyury homolog (mouse)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003181.2-2232s21c1
Sequence:CCGGTAGTTAGAGTTGAGCTGTTAACTCGAGTTAACAGCTCAACTCTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003181.2-2174s21c1
Sequence:CCGGGTCCTACTTTAGTGAGATAAACTCGAGTTTATCTCACTAAAGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003181.2-2350s1c1
Sequence:CCGGGCTAATCTCTTGTGTTGTTAACTCGAGTTAACAACACAAGAGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-982s1c1
Sequence:CCGGGCATAAGTATGAGCCTCGAATCTCGAGATTCGAGGCTCATACTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-1093s1c1
Sequence:CCGGCGAGGAGATCACAGCTCTTAACTCGAGTTAAGAGCTGTGATCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-1418s1c1
Sequence:CCGGGCATGTTTATCCATGCTGCAACTCGAGTTGCAGCATGGATAAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-998s1c1
Sequence:CCGGCGAATCCACATAGTGAGAGTTCTCGAGAACTCTCACTATGTGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003181
T MISSION shRNA shRNA Plasmid DNA
T, brachyury homolog (mouse)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003181.2-2232s21c1
Sequence:CCGGTAGTTAGAGTTGAGCTGTTAACTCGAGTTAACAGCTCAACTCTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003181.2-2174s21c1
Sequence:CCGGGTCCTACTTTAGTGAGATAAACTCGAGTTTATCTCACTAAAGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003181.2-2350s1c1
Sequence:CCGGGCTAATCTCTTGTGTTGTTAACTCGAGTTAACAACACAAGAGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-982s1c1
Sequence:CCGGGCATAAGTATGAGCCTCGAATCTCGAGATTCGAGGCTCATACTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-1093s1c1
Sequence:CCGGCGAGGAGATCACAGCTCTTAACTCGAGTTAAGAGCTGTGATCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-1418s1c1
Sequence:CCGGGCATGTTTATCCATGCTGCAACTCGAGTTGCAGCATGGATAAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-998s1c1
Sequence:CCGGCGAATCCACATAGTGAGAGTTCTCGAGAACTCTCACTATGTGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003181
T MISSION shRNA Lentiviral Transduction Particles
T, brachyury homolog (mouse)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003181.2-2232s21c1
Sequence:CCGGTAGTTAGAGTTGAGCTGTTAACTCGAGTTAACAGCTCAACTCTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003181.2-2174s21c1
Sequence:CCGGGTCCTACTTTAGTGAGATAAACTCGAGTTTATCTCACTAAAGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003181.2-2350s1c1
Sequence:CCGGGCTAATCTCTTGTGTTGTTAACTCGAGTTAACAACACAAGAGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-982s1c1
Sequence:CCGGGCATAAGTATGAGCCTCGAATCTCGAGATTCGAGGCTCATACTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-1093s1c1
Sequence:CCGGCGAGGAGATCACAGCTCTTAACTCGAGTTAAGAGCTGTGATCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-1418s1c1
Sequence:CCGGGCATGTTTATCCATGCTGCAACTCGAGTTGCAGCATGGATAAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003181.2-998s1c1
Sequence:CCGGCGAATCCACATAGTGAGAGTTCTCGAGAACTCTCACTATGTGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009309
T MISSION shRNA Bacterial Glycerol Stock
T, brachyury homolog (mouse)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009309.2-1826s21c1
Sequence:CCGGTGTTGCCTTAGAGTAGTTAACCTCGAGGTTAACTACTCTAAGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009309.2-1616s21c1
Sequence:CCGGAGTGATATGTGTCCTACATTACTCGAGTAATGTAGGACACATATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-277s1c1
Sequence:CCGGGAGCTAACTAACGAGATGATTCTCGAGAATCATCTCGTTAGTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-708s1c1
Sequence:CCGGTGAGGAGATTACAGCCCTTAACTCGAGTTAAGGGCTGTAATCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-755s1c1
Sequence:CCGGCCTTCCTTGATGCCAAAGAAACTCGAGTTTCTTTGGCATCAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009309.1-1457s1c1
Sequence:CCGGCGGTGTCAACTGGATCTTCTACTCGAGTAGAAGATCCAGTTGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-613s1c1
Sequence:CCGGCGGATTCACATCGTGAGAGTTCTCGAGAACTCTCACGATGTGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009309
T MISSION shRNA shRNA Plasmid DNA
T, brachyury homolog (mouse)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009309.2-1826s21c1
Sequence:CCGGTGTTGCCTTAGAGTAGTTAACCTCGAGGTTAACTACTCTAAGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009309.2-1616s21c1
Sequence:CCGGAGTGATATGTGTCCTACATTACTCGAGTAATGTAGGACACATATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-277s1c1
Sequence:CCGGGAGCTAACTAACGAGATGATTCTCGAGAATCATCTCGTTAGTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-708s1c1
Sequence:CCGGTGAGGAGATTACAGCCCTTAACTCGAGTTAAGGGCTGTAATCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-755s1c1
Sequence:CCGGCCTTCCTTGATGCCAAAGAAACTCGAGTTTCTTTGGCATCAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009309.1-1457s1c1
Sequence:CCGGCGGTGTCAACTGGATCTTCTACTCGAGTAGAAGATCCAGTTGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-613s1c1
Sequence:CCGGCGGATTCACATCGTGAGAGTTCTCGAGAACTCTCACGATGTGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009309
T MISSION shRNA Lentiviral Transduction Particles
T, brachyury homolog (mouse)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009309.2-1826s21c1
Sequence:CCGGTGTTGCCTTAGAGTAGTTAACCTCGAGGTTAACTACTCTAAGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009309.2-1616s21c1
Sequence:CCGGAGTGATATGTGTCCTACATTACTCGAGTAATGTAGGACACATATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-277s1c1
Sequence:CCGGGAGCTAACTAACGAGATGATTCTCGAGAATCATCTCGTTAGTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-708s1c1
Sequence:CCGGTGAGGAGATTACAGCCCTTAACTCGAGTTAAGGGCTGTAATCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-755s1c1
Sequence:CCGGCCTTCCTTGATGCCAAAGAAACTCGAGTTTCTTTGGCATCAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009309.1-1457s1c1
Sequence:CCGGCGGTGTCAACTGGATCTTCTACTCGAGTAGAAGATCCAGTTGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009309.1-613s1c1
Sequence:CCGGCGGATTCACATCGTGAGAGTTCTCGAGAACTCTCACGATGTGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks