EMAIL THIS PAGE TO A FRIEND

TAAR1

trace amine associated receptor 1

Synonyms: RP11-295F4.9 TA1 TAR1 TRAR1
UniProtKB ID: Q96RJ0, Q2M1W5, Q3MIH8, Q5VUQ1
Gene ID:
Human(134864) Summary: TAAR1 is a G protein-coupled receptor activated by trace amines. Trace amines are endogenous amine compounds that account for less than 1% of the biogenic amines in most brain regions (Bunzow et al., 2001 [PubMed 11723224]
Mouse(111174) trace amine-associated receptor 1
Rat(113914) trace-amine-associated receptor 1
chicken(768536) trace amine associated receptor 1
domestic cat(101096731) trace amine associated receptor 1
cow(785788) trace amine associated receptor 1
sheep(101119733) trace amine associated receptor 1
domestic guinea pig(100728399) trace amine associated receptor 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138327 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002061 MISSION® esiRNA esiRNA targeting human TAAR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138327 Rosetta Predictions human pricing
NM_134328 Rosetta Predictions rat pricing
NM_053205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134799 predicted 627
2 SASI_Hs01_00134800 predicted 569
3 SASI_Hs01_00134801 predicted 599
4 SASI_Hs01_00134802 predicted 239
5 SASI_Hs02_00363414 predicted 626
6 SASI_Hs01_00134803 predicted 361
7 SASI_Hs01_00134805 predicted 622
8 SASI_Hs01_00134806 predicted 382
9 SASI_Hs01_00134807 predicted 772
10 SASI_Hs01_00134808 predicted 373
11 SASI_Hs01_00134804 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095612 predicted 654
2 SASI_Rn01_00095613 predicted 657
3 SASI_Rn01_00095614 predicted 650
4 SASI_Rn02_00267869 predicted 575
5 SASI_Rn01_00095615 predicted 380
6 SASI_Rn02_00267870 predicted 591
7 SASI_Rn01_00095617 predicted 605
8 SASI_Rn01_00095618 predicted 496
9 SASI_Rn01_00095619 predicted 465
10 SASI_Rn01_00095621 predicted 248
11 SASI_Rn01_00095616 predicted 649
12 SASI_Rn01_00095620 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097287 predicted 575
2 SASI_Mm01_00097288 predicted 401
3 SASI_Mm02_00337783 predicted 327
4 SASI_Mm01_00097289 predicted 655
5 SASI_Mm01_00097290 predicted 587
6 SASI_Mm01_00097291 predicted 415
7 SASI_Mm01_00097292 predicted 681
8 SASI_Mm01_00097293 predicted 243
9 SASI_Mm01_00097294 predicted 445
10 SASI_Mm01_00097295 predicted 626
11 SASI_Mm01_00097296 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053205
TAAR1 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053205.1-79s21c1
Sequence:CCGGAGCTTAATGTCACTCATAATCCTCGAGGATTATGAGTGACATTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053205.1-776s21c1
Sequence:CCGGTATGCTGGTGCCCGTTCTTTCCTCGAGGAAAGAACGGGCACCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-104s1c1
Sequence:CCGGCCACTCTGGTTGGCAACTTAACTCGAGTTAAGTTGCCAACCAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-395s1c1
Sequence:CCGGCCAAGATCAATATCTCCACTACTCGAGTAGTGGAGATATTGATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-378s1c1
Sequence:CCGGCCCTTTGAGATACAAAGCCAACTCGAGTTGGCTTTGTATCTCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-153s1c1
Sequence:CCGGGCAACTTCATACACCCACCAACTCGAGTTGGTGGGTGTATGAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053205
TAAR1 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053205.1-79s21c1
Sequence:CCGGAGCTTAATGTCACTCATAATCCTCGAGGATTATGAGTGACATTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053205.1-776s21c1
Sequence:CCGGTATGCTGGTGCCCGTTCTTTCCTCGAGGAAAGAACGGGCACCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-104s1c1
Sequence:CCGGCCACTCTGGTTGGCAACTTAACTCGAGTTAAGTTGCCAACCAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-395s1c1
Sequence:CCGGCCAAGATCAATATCTCCACTACTCGAGTAGTGGAGATATTGATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-378s1c1
Sequence:CCGGCCCTTTGAGATACAAAGCCAACTCGAGTTGGCTTTGTATCTCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-153s1c1
Sequence:CCGGGCAACTTCATACACCCACCAACTCGAGTTGGTGGGTGTATGAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053205
TAAR1 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053205.1-79s21c1
Sequence:CCGGAGCTTAATGTCACTCATAATCCTCGAGGATTATGAGTGACATTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053205.1-776s21c1
Sequence:CCGGTATGCTGGTGCCCGTTCTTTCCTCGAGGAAAGAACGGGCACCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-104s1c1
Sequence:CCGGCCACTCTGGTTGGCAACTTAACTCGAGTTAAGTTGCCAACCAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-395s1c1
Sequence:CCGGCCAAGATCAATATCTCCACTACTCGAGTAGTGGAGATATTGATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-378s1c1
Sequence:CCGGCCCTTTGAGATACAAAGCCAACTCGAGTTGGCTTTGTATCTCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053205.1-153s1c1
Sequence:CCGGGCAACTTCATACACCCACCAACTCGAGTTGGTGGGTGTATGAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138327
TAAR1 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-293s21c1
Sequence:CCGGTTCACACAAGCACCGACATTACTCGAGTAATGTCGGTGCTTGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-598s21c1
Sequence:CCGGTATATACCTGGATCTATTATGCTCGAGCATAATAGATCCAGGTATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-376s21c1
Sequence:CCGGTGTGATCCACTGAGATATAAACTCGAGTTTATATCTCAGTGGATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-81s21c1
Sequence:CCGGCAGTTTAATGGTGCTCATAATCTCGAGATTATGAGCACCATTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-690s1c1
Sequence:CCGGGCTCCAAATTGGATTGGAAATCTCGAGATTTCCAATCCAATTTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-78s1c1
Sequence:CCGGGTACAGTTTAATGGTGCTCATCTCGAGATGAGCACCATTAAACTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-780s1c1
Sequence:CCGGCCTAATATGCTGGTGCCCTTTCTCGAGAAAGGGCACCAGCATATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-397s1c1
Sequence:CCGGGCCAAGATGAATATCTTGGTTCTCGAGAACCAAGATATTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-844s1c1
Sequence:CCGGCCACCTACTTTGAATGATGTACTCGAGTACATCATTCAAAGTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138327
TAAR1 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-293s21c1
Sequence:CCGGTTCACACAAGCACCGACATTACTCGAGTAATGTCGGTGCTTGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-598s21c1
Sequence:CCGGTATATACCTGGATCTATTATGCTCGAGCATAATAGATCCAGGTATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-376s21c1
Sequence:CCGGTGTGATCCACTGAGATATAAACTCGAGTTTATATCTCAGTGGATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-81s21c1
Sequence:CCGGCAGTTTAATGGTGCTCATAATCTCGAGATTATGAGCACCATTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-690s1c1
Sequence:CCGGGCTCCAAATTGGATTGGAAATCTCGAGATTTCCAATCCAATTTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-78s1c1
Sequence:CCGGGTACAGTTTAATGGTGCTCATCTCGAGATGAGCACCATTAAACTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-780s1c1
Sequence:CCGGCCTAATATGCTGGTGCCCTTTCTCGAGAAAGGGCACCAGCATATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-397s1c1
Sequence:CCGGGCCAAGATGAATATCTTGGTTCTCGAGAACCAAGATATTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-844s1c1
Sequence:CCGGCCACCTACTTTGAATGATGTACTCGAGTACATCATTCAAAGTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138327
TAAR1 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-293s21c1
Sequence:CCGGTTCACACAAGCACCGACATTACTCGAGTAATGTCGGTGCTTGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-598s21c1
Sequence:CCGGTATATACCTGGATCTATTATGCTCGAGCATAATAGATCCAGGTATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-376s21c1
Sequence:CCGGTGTGATCCACTGAGATATAAACTCGAGTTTATATCTCAGTGGATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138327.1-81s21c1
Sequence:CCGGCAGTTTAATGGTGCTCATAATCTCGAGATTATGAGCACCATTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-690s1c1
Sequence:CCGGGCTCCAAATTGGATTGGAAATCTCGAGATTTCCAATCCAATTTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-78s1c1
Sequence:CCGGGTACAGTTTAATGGTGCTCATCTCGAGATGAGCACCATTAAACTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-780s1c1
Sequence:CCGGCCTAATATGCTGGTGCCCTTTCTCGAGAAAGGGCACCAGCATATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-397s1c1
Sequence:CCGGGCCAAGATGAATATCTTGGTTCTCGAGAACCAAGATATTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138327.1-844s1c1
Sequence:CCGGCCACCTACTTTGAATGATGTACTCGAGTACATCATTCAAAGTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks