EMAIL THIS PAGE TO A FRIEND

TAAR2

trace amine associated receptor 2

Synonyms: GPR58
UniProtKB ID: Q9P1P5, Q5QD02, Q6NWS1, Q6NWS2, Q6NWS3
Gene ID:
Mouse(209512) trace amine-associated receptor 2
Rat(294121) trace amine-associated receptor 2
chicken(100859322) trace amine associated receptor 2
Horse(100073123) trace amine associated receptor 2
domestic cat(101080637) trace amine associated receptor 2
domestic guinea pig(100732187) trace amine associated receptor 2
naked mole-rat(101707694) trace amine associated receptor 2
cow(785719) trace amine associated receptor 2
sheep(101104757) trace amine associated receptor 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150091 MISSION® esiRNA esiRNA human TAAR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033080 Rosetta Predictions human pricing
NM_014626 Rosetta Predictions human pricing
NM_001008512 Rosetta Predictions rat pricing
XM_579190 Rosetta Predictions rat pricing
NM_001007266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023876 predicted 359
2 SASI_Hs01_00023877 predicted 374
3 SASI_Hs01_00023878 predicted 538
4 SASI_Hs01_00023879 predicted 713
5 SASI_Hs01_00023880 predicted 792
6 SASI_Hs01_00023881 predicted 717
7 SASI_Hs01_00023882 predicted 585
8 SASI_Hs01_00023883 predicted 483
9 SASI_Hs01_00023884 predicted 631
10 SASI_Hs01_00023885 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073521 predicted 245
2 SASI_Hs01_00073522 predicted 261
3 SASI_Hs01_00073523 predicted 427
4 SASI_Hs01_00073524 predicted 597
5 SASI_Hs01_00073525 predicted 672
6 SASI_Hs01_00073526 predicted 610
7 SASI_Hs01_00073527 predicted 481
8 SASI_Hs01_00073528 predicted 367
9 SASI_Hs01_00073529 predicted 514
10 SASI_Hs01_00073530 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115267 predicted 591
2 SASI_Rn01_00115268 predicted 219
3 SASI_Rn02_00199191 predicted 354
4 SASI_Rn02_00199192 predicted 399
5 SASI_Rn01_00115269 predicted 517
6 SASI_Rn01_00115270 predicted 234
7 SASI_Rn01_00115272 predicted 595
8 SASI_Rn01_00115273 predicted 324
9 SASI_Rn01_00115274 predicted 560
10 SASI_Rn01_00115275 predicted 338
11 SASI_Rn01_00115266 predicted 308
12 SASI_Rn01_00115271 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136013 predicted 313
2 SASI_Rn01_00136014 predicted 601
3 SASI_Rn01_00136015 predicted 230
4 SASI_Rn01_00136016 predicted 519
5 SASI_Rn01_00136017 predicted 243
6 SASI_Rn01_00136018 predicted 260
7 SASI_Rn01_00136019 predicted 599
8 SASI_Rn01_00136020 predicted 332
9 SASI_Rn01_00136021 predicted 568
10 SASI_Rn01_00136022 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101946 predicted 284
2 SASI_Mm01_00101947 predicted 568
3 SASI_Mm01_00101948 predicted 240
4 SASI_Mm01_00101949 predicted 510
5 SASI_Mm01_00101950 predicted 288
6 SASI_Mm01_00101951 predicted 281
7 SASI_Mm01_00101952 predicted 749
8 SASI_Mm01_00101953 predicted 323
9 SASI_Mm01_00101954 predicted 323
10 SASI_Mm01_00101955 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014626
TAAR2 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-497s1c1
Sequence:CCGGCCACCTTGTTTATGGCAGGTTCTCGAGAACCTGCCATAAACAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-295s1c1
Sequence:CCGGGCTATATGTTACCCATTACTTCTCGAGAAGTAATGGGTAACATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-589s1c1
Sequence:CCGGGCCATCAATAACTTGCGAGAACTCGAGTTCTCGCAAGTTATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-469s1c1
Sequence:CCGGCCAGTGATGTTCAACAAGCTACTCGAGTAGCTTGTTGAACATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-53s1c1
Sequence:CCGGCCATGATAATTTCCATTTCCTCTCGAGAGGAAATGGAAATTATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-316s21c1
Sequence:CCGGATGCTATATGTTACCCATTACCTCGAGGTAATGGGTAACATATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-66s21c1
Sequence:CCGGGGCAATCTTGCCATGATAATTCTCGAGAATTATCATGGCAAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-167s21c1
Sequence:CCGGATTCACCATCATGCCATATAGCTCGAGCTATATGGCATGATGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-262s21c1
Sequence:CCGGTGCTTAGCATAACATCCATTTCTCGAGAAATGGATGTTATGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014626
TAAR2 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-497s1c1
Sequence:CCGGCCACCTTGTTTATGGCAGGTTCTCGAGAACCTGCCATAAACAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-295s1c1
Sequence:CCGGGCTATATGTTACCCATTACTTCTCGAGAAGTAATGGGTAACATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-589s1c1
Sequence:CCGGGCCATCAATAACTTGCGAGAACTCGAGTTCTCGCAAGTTATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-469s1c1
Sequence:CCGGCCAGTGATGTTCAACAAGCTACTCGAGTAGCTTGTTGAACATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-53s1c1
Sequence:CCGGCCATGATAATTTCCATTTCCTCTCGAGAGGAAATGGAAATTATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-316s21c1
Sequence:CCGGATGCTATATGTTACCCATTACCTCGAGGTAATGGGTAACATATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-66s21c1
Sequence:CCGGGGCAATCTTGCCATGATAATTCTCGAGAATTATCATGGCAAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-167s21c1
Sequence:CCGGATTCACCATCATGCCATATAGCTCGAGCTATATGGCATGATGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-262s21c1
Sequence:CCGGTGCTTAGCATAACATCCATTTCTCGAGAAATGGATGTTATGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014626
TAAR2 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-497s1c1
Sequence:CCGGCCACCTTGTTTATGGCAGGTTCTCGAGAACCTGCCATAAACAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-295s1c1
Sequence:CCGGGCTATATGTTACCCATTACTTCTCGAGAAGTAATGGGTAACATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-589s1c1
Sequence:CCGGGCCATCAATAACTTGCGAGAACTCGAGTTCTCGCAAGTTATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-469s1c1
Sequence:CCGGCCAGTGATGTTCAACAAGCTACTCGAGTAGCTTGTTGAACATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014626.1-53s1c1
Sequence:CCGGCCATGATAATTTCCATTTCCTCTCGAGAGGAAATGGAAATTATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-316s21c1
Sequence:CCGGATGCTATATGTTACCCATTACCTCGAGGTAATGGGTAACATATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-66s21c1
Sequence:CCGGGGCAATCTTGCCATGATAATTCTCGAGAATTATCATGGCAAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-167s21c1
Sequence:CCGGATTCACCATCATGCCATATAGCTCGAGCTATATGGCATGATGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014626.3-262s21c1
Sequence:CCGGTGCTTAGCATAACATCCATTTCTCGAGAAATGGATGTTATGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007266
TAAR2 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-511s1c1
Sequence:CCGGGCTTACGCTGATGGAATTGAACTCGAGTTCAATTCCATCAGCGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-810s1c1
Sequence:CCGGCCTGTTAGATCCGTTTCTGAACTCGAGTTCAGAAACGGATCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-406s1c1
Sequence:CCGGCCTTTGCATTATTGCACCAAACTCGAGTTTGGTGCAATAATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-234s1c1
Sequence:CCGGCCTTCTCGGATTCACCATCATCTCGAGATGATGGTGAATCCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007266.1-34s1c1
Sequence:CCGGGATTGTTCAGAGTACGGAAATCTCGAGATTTCCGTACTCTGAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-687s1c1
Sequence:CCGGCGTAATTGACAACTTGCCAGACTCGAGTCTGGCAAGTTGTCAATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007266.1-56s1c1
Sequence:CCGGGATCTTGCCCAGAGAATGAAACTCGAGTTTCATTCTCTGGGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007266
TAAR2 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-511s1c1
Sequence:CCGGGCTTACGCTGATGGAATTGAACTCGAGTTCAATTCCATCAGCGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-810s1c1
Sequence:CCGGCCTGTTAGATCCGTTTCTGAACTCGAGTTCAGAAACGGATCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-406s1c1
Sequence:CCGGCCTTTGCATTATTGCACCAAACTCGAGTTTGGTGCAATAATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-234s1c1
Sequence:CCGGCCTTCTCGGATTCACCATCATCTCGAGATGATGGTGAATCCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007266.1-34s1c1
Sequence:CCGGGATTGTTCAGAGTACGGAAATCTCGAGATTTCCGTACTCTGAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-687s1c1
Sequence:CCGGCGTAATTGACAACTTGCCAGACTCGAGTCTGGCAAGTTGTCAATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007266.1-56s1c1
Sequence:CCGGGATCTTGCCCAGAGAATGAAACTCGAGTTTCATTCTCTGGGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007266
TAAR2 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-511s1c1
Sequence:CCGGGCTTACGCTGATGGAATTGAACTCGAGTTCAATTCCATCAGCGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-810s1c1
Sequence:CCGGCCTGTTAGATCCGTTTCTGAACTCGAGTTCAGAAACGGATCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-406s1c1
Sequence:CCGGCCTTTGCATTATTGCACCAAACTCGAGTTTGGTGCAATAATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-234s1c1
Sequence:CCGGCCTTCTCGGATTCACCATCATCTCGAGATGATGGTGAATCCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007266.1-34s1c1
Sequence:CCGGGATTGTTCAGAGTACGGAAATCTCGAGATTTCCGTACTCTGAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007266.1-687s1c1
Sequence:CCGGCGTAATTGACAACTTGCCAGACTCGAGTCTGGCAAGTTGTCAATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007266.1-56s1c1
Sequence:CCGGGATCTTGCCCAGAGAATGAAACTCGAGTTTCATTCTCTGGGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks