EMAIL THIS PAGE TO A FRIEND

TAAR3

trace amine associated receptor 3 (gene/pseudogene)

Synonyms: GPR57 GPR58 TAAR2
UniProtKB ID: Q9P1P4
Gene ID:
Mouse(493809) trace amine-associated receptor 3
Rat(494319) trace amine-associated receptor 3
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003361 MISSION® esiRNA esiRNA targeting mouse Taar3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009532 Rosetta Predictions rat pricing
NM_001008429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043177 predicted 521
2 SASI_Rn01_00043178 predicted 237
3 SASI_Rn01_00043179 predicted 351
4 SASI_Rn01_00043180 predicted 758
5 SASI_Rn01_00043181 predicted 559
6 SASI_Rn01_00043182 predicted 270
7 SASI_Rn01_00043183 predicted 421
8 SASI_Rn01_00043184 predicted 331
9 SASI_Rn01_00043185 predicted 283
10 SASI_Rn01_00043186 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035318 predicted 628
2 SASI_Mm01_00035319 predicted 519
3 SASI_Mm01_00035320 predicted 691
4 SASI_Mm02_00286799 predicted 314
5 SASI_Mm01_00035322 predicted 217
6 SASI_Mm01_00035323 predicted 395
7 SASI_Mm02_00286800 predicted 752
8 SASI_Mm01_00035324 predicted 632
9 SASI_Mm01_00035325 predicted 530
10 SASI_Mm01_00035326 predicted 421
11 SASI_Mm01_00035321 predicted 571
12 SASI_Mm01_00035327 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008429
TAAR3 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 3 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-91s1c1
Sequence:CCGGCGCATGATAATGTACCTGTTTCTCGAGAAACAGGTACATTATCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-533s1c1
Sequence:CCGGGCTACGAGATTCTTGTTGCTTCTCGAGAAGCAACAAGAATCTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-629s1c1
Sequence:CCGGGCTCCATCATGGTTGGTATTTCTCGAGAAATACCAACCATGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-568s1c1
Sequence:CCGGGCGCTTACGTTCAACAAGTTTCTCGAGAAACTTGTTGAACGTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-170s1c1
Sequence:CCGGCGCATTTCAAACAGCTACATTCTCGAGAATGTAGCTGTTTGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008429
TAAR3 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 3 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-91s1c1
Sequence:CCGGCGCATGATAATGTACCTGTTTCTCGAGAAACAGGTACATTATCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-533s1c1
Sequence:CCGGGCTACGAGATTCTTGTTGCTTCTCGAGAAGCAACAAGAATCTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-629s1c1
Sequence:CCGGGCTCCATCATGGTTGGTATTTCTCGAGAAATACCAACCATGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-568s1c1
Sequence:CCGGGCGCTTACGTTCAACAAGTTTCTCGAGAAACTTGTTGAACGTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-170s1c1
Sequence:CCGGCGCATTTCAAACAGCTACATTCTCGAGAATGTAGCTGTTTGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008429
TAAR3 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 3 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-91s1c1
Sequence:CCGGCGCATGATAATGTACCTGTTTCTCGAGAAACAGGTACATTATCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-533s1c1
Sequence:CCGGGCTACGAGATTCTTGTTGCTTCTCGAGAAGCAACAAGAATCTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-629s1c1
Sequence:CCGGGCTCCATCATGGTTGGTATTTCTCGAGAAATACCAACCATGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-568s1c1
Sequence:CCGGGCGCTTACGTTCAACAAGTTTCTCGAGAAACTTGTTGAACGTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008429.1-170s1c1
Sequence:CCGGCGCATTTCAAACAGCTACATTCTCGAGAATGTAGCTGTTTGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks