EMAIL THIS PAGE TO A FRIEND

TAAR5

trace amine associated receptor 5

Synonyms: PNR RP11-295F4.5
UniProtKB ID: O14804, D8KZS1, Q2M1V1, Q4VBL1, Q5VUQ3, Q6NTA8
Gene ID:
Mouse(215854) trace amine-associated receptor 5
Rat(294123) trace amine-associated receptor 5
chicken(768558) trace amine associated receptor 5
dog(483989) trace amine associated receptor 5
domestic cat(101095981) trace amine associated receptor 5
cow(509368) trace amine associated receptor 5
naked mole-rat(101722467) trace amine associated receptor 5
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003967 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001009574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132141 MISSION® esiRNA esiRNA human TAAR5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003967 Rosetta Predictions human pricing
NM_001009650 Rosetta Predictions rat pricing
XM_579307 Rosetta Predictions rat pricing
NM_001009574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219926 predicted 548
2 SASI_Hs01_00219928 predicted 759
3 SASI_Hs01_00219929 predicted 506
4 SASI_Hs01_00219930 predicted 414
5 SASI_Hs02_00336647 predicted 745
6 SASI_Hs01_00219931 predicted 597
7 SASI_Hs01_00219933 predicted 680
8 SASI_Hs01_00219934 predicted 631
9 SASI_Hs01_00219935 predicted 482
10 SASI_Hs02_00336648 predicted 496
11 SASI_Hs01_00219927 predicted 604
12 SASI_Hs01_00219932 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036983 predicted 438
2 SASI_Rn01_00036984 predicted 386
3 SASI_Rn01_00036985 predicted 571
4 SASI_Rn02_00199677 predicted 718
5 SASI_Rn01_00036986 predicted 603
6 SASI_Rn01_00036987 predicted 598
7 SASI_Rn01_00036988 predicted 530
8 SASI_Rn01_00036989 predicted 355
9 SASI_Rn01_00036991 predicted 439
10 SASI_Rn01_00036992 predicted 682
11 SASI_Rn01_00036990 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142301 predicted 437
2 SASI_Rn01_00142302 predicted 396
3 SASI_Rn01_00142303 predicted 579
4 SASI_Rn01_00142304 predicted 603
5 SASI_Rn01_00142305 predicted 605
6 SASI_Rn01_00142306 predicted 528
7 SASI_Rn01_00142307 predicted 367
8 SASI_Rn01_00142308 predicted 279
9 SASI_Rn01_00142309 predicted 443
10 SASI_Rn01_00142310 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022865 predicted 411
2 SASI_Mm01_00022866 predicted 631
3 SASI_Mm01_00022867 predicted 529
4 SASI_Mm01_00022868 predicted 604
5 SASI_Mm01_00022869 predicted 687
6 SASI_Mm01_00022870 predicted 391
7 SASI_Mm01_00022871 predicted 235
8 SASI_Mm01_00022872 predicted 503
9 SASI_Mm02_00286866 predicted 308
10 SASI_Mm01_00022874 predicted 510
11 SASI_Mm01_00022873 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003967
TAAR5 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-486s1c1
Sequence:CCGGCGCAGCATACACTTCGTTATTCTCGAGAATAACGAAGTGTATGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-850s1c1
Sequence:CCGGCCACTGGTCTTTGACATCTTTCTCGAGAAAGATGTCAAAGACCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-693s1c1
Sequence:CCGGGCAGATTACCACATTGAGCAACTCGAGTTGCTCAATGTGGTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-636s1c1
Sequence:CCGGCCTCATTATGATCAGCTTGTACTCGAGTACAAGCTGATCATAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-43s1c1
Sequence:CCGGGCATTCTGCTACCAGGTGAATCTCGAGATTCACCTGGTAGCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-815s21c1
Sequence:CCGGGGCATTGCTGTGGGCATATACCTCGAGGTATATGCCCACAGCAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-537s21c1
Sequence:CCGGCCGCAGCATACACTTCGTTATCTCGAGATAACGAAGTGTATGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-873s21c1
Sequence:CCGGTCGACAGCCTCCTTCACTTTACTCGAGTAAAGTGAAGGAGGCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003967
TAAR5 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-486s1c1
Sequence:CCGGCGCAGCATACACTTCGTTATTCTCGAGAATAACGAAGTGTATGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-850s1c1
Sequence:CCGGCCACTGGTCTTTGACATCTTTCTCGAGAAAGATGTCAAAGACCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-693s1c1
Sequence:CCGGGCAGATTACCACATTGAGCAACTCGAGTTGCTCAATGTGGTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-636s1c1
Sequence:CCGGCCTCATTATGATCAGCTTGTACTCGAGTACAAGCTGATCATAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-43s1c1
Sequence:CCGGGCATTCTGCTACCAGGTGAATCTCGAGATTCACCTGGTAGCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-815s21c1
Sequence:CCGGGGCATTGCTGTGGGCATATACCTCGAGGTATATGCCCACAGCAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-537s21c1
Sequence:CCGGCCGCAGCATACACTTCGTTATCTCGAGATAACGAAGTGTATGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-873s21c1
Sequence:CCGGTCGACAGCCTCCTTCACTTTACTCGAGTAAAGTGAAGGAGGCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003967
TAAR5 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-486s1c1
Sequence:CCGGCGCAGCATACACTTCGTTATTCTCGAGAATAACGAAGTGTATGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-850s1c1
Sequence:CCGGCCACTGGTCTTTGACATCTTTCTCGAGAAAGATGTCAAAGACCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-693s1c1
Sequence:CCGGGCAGATTACCACATTGAGCAACTCGAGTTGCTCAATGTGGTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-636s1c1
Sequence:CCGGCCTCATTATGATCAGCTTGTACTCGAGTACAAGCTGATCATAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003967.1-43s1c1
Sequence:CCGGGCATTCTGCTACCAGGTGAATCTCGAGATTCACCTGGTAGCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-815s21c1
Sequence:CCGGGGCATTGCTGTGGGCATATACCTCGAGGTATATGCCCACAGCAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-537s21c1
Sequence:CCGGCCGCAGCATACACTTCGTTATCTCGAGATAACGAAGTGTATGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003967.2-873s21c1
Sequence:CCGGTCGACAGCCTCCTTCACTTTACTCGAGTAAAGTGAAGGAGGCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009574
TAAR5 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-636s1c1
Sequence:CCGGCCTAATCATGATCAGCTTGTACTCGAGTACAAGCTGATCATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-499s1c1
Sequence:CCGGGCCTTCTTCCTCTACACAGATCTCGAGATCTGTGTAGAGGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-699s1c1
Sequence:CCGGCAGAACTCTGAGCCAAAGCTTCTCGAGAAGCTTTGGCTCAGAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-359s1c1
Sequence:CCGGCCTCCATCTTCCATCTCTGTTCTCGAGAACAGAGATGGAAGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009574.1-883s21c1
Sequence:CCGGTATTTCAATTCAGCCTGTAATCTCGAGATTACAGGCTGAATTGAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009574
TAAR5 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-636s1c1
Sequence:CCGGCCTAATCATGATCAGCTTGTACTCGAGTACAAGCTGATCATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-499s1c1
Sequence:CCGGGCCTTCTTCCTCTACACAGATCTCGAGATCTGTGTAGAGGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-699s1c1
Sequence:CCGGCAGAACTCTGAGCCAAAGCTTCTCGAGAAGCTTTGGCTCAGAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-359s1c1
Sequence:CCGGCCTCCATCTTCCATCTCTGTTCTCGAGAACAGAGATGGAAGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009574.1-883s21c1
Sequence:CCGGTATTTCAATTCAGCCTGTAATCTCGAGATTACAGGCTGAATTGAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009574
TAAR5 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-636s1c1
Sequence:CCGGCCTAATCATGATCAGCTTGTACTCGAGTACAAGCTGATCATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-499s1c1
Sequence:CCGGGCCTTCTTCCTCTACACAGATCTCGAGATCTGTGTAGAGGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-699s1c1
Sequence:CCGGCAGAACTCTGAGCCAAAGCTTCTCGAGAAGCTTTGGCTCAGAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009574.1-359s1c1
Sequence:CCGGCCTCCATCTTCCATCTCTGTTCTCGAGAACAGAGATGGAAGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009574.1-883s21c1
Sequence:CCGGTATTTCAATTCAGCCTGTAATCTCGAGATTACAGGCTGAATTGAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks