EMAIL THIS PAGE TO A FRIEND

TAAR6

trace amine associated receptor 6

Synonyms: RP11-295F4.3 TA4 TAR4 TAR6 TRAR4 taR-4 taR-6
UniProtKB ID: Q96RI8, Q5VUQ4
Gene ID:
Human(319100) Summary: This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Mouse(215855) trace amine-associated receptor 6
Rat(294124) trace amine-associated receptor 6
cow(783342) trace amine associated receptor 6
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001010828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001010828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024761 MISSION® esiRNA esiRNA human TAAR6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175067 Rosetta Predictions human pricing
NM_175584 Rosetta Predictions rat pricing
NM_001010828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079764 predicted 558
2 SASI_Hs01_00079766 predicted 561
3 SASI_Hs01_00079767 predicted 426
4 SASI_Hs01_00079768 predicted 554
5 SASI_Hs01_00079769 predicted 702
6 SASI_Hs01_00079771 predicted 419
7 SASI_Hs01_00079772 predicted 537
8 SASI_Hs01_00079773 predicted 612
9 SASI_Hs02_00368975 predicted 606
10 SASI_Hs01_00079770 predicted 616
11 SASI_Hs01_00079765 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269489 predicted 692
2 SASI_Rn01_00075112 predicted 465
3 SASI_Rn01_00075113 predicted 198
4 SASI_Rn01_00075114 predicted 811
5 SASI_Rn01_00075115 predicted 565
6 SASI_Rn01_00075116 predicted 770
7 SASI_Rn01_00075117 predicted 785
8 SASI_Rn01_00075118 predicted 622
9 SASI_Rn01_00075119 predicted 789
10 SASI_Rn01_00075120 predicted 244
11 SASI_Rn01_00075121 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186630 predicted 207
2 SASI_Mm01_00186631 predicted 616
3 SASI_Mm01_00186632 predicted 565
4 SASI_Mm01_00186634 predicted 329
5 SASI_Mm01_00186635 predicted 813
6 SASI_Mm01_00186636 predicted 788
7 SASI_Mm01_00186637 predicted 288
8 SASI_Mm01_00186638 predicted 224
9 SASI_Mm01_00186639 predicted 629
10 SASI_Mm02_00286894 predicted 787
11 SASI_Mm01_00186633 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175067
TAAR6 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-840s21c1
Sequence:CCGGTGATGCCTTTATGGGCTTTATCTCGAGATAAAGCCCATAAAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-565s21c1
Sequence:CCGGGGTTGTCAGACCGTTGTAAATCTCGAGATTTACAACGGTCTGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-802s21c1
Sequence:CCGGATGATTTCATGGTTACCATATCTCGAGATATGGTAACCATGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-535s21c1
Sequence:CCGGGAATTATCTGATGCCCTAAACCTCGAGGTTTAGGGCATCAGATAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-841s1c1
Sequence:CCGGGATGCCTTTATGGGCTTTATACTCGAGTATAAAGCCCATAAAGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-548s1c1
Sequence:CCGGCCCTAAACTGTATAGGAGGTTCTCGAGAACCTCCTATACAGTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-865s1c1
Sequence:CCGGCCTGCCTGTATTTATGAGATTCTCGAGAATCTCATAAATACAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-653s1c1
Sequence:CCGGGTAACATATTTCTTGTGGCTACTCGAGTAGCCACAAGAAATATGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-150s1c1
Sequence:CCGGCCTCCTGGTGATGATTTCAATCTCGAGATTGAAATCATCACCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175067
TAAR6 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-840s21c1
Sequence:CCGGTGATGCCTTTATGGGCTTTATCTCGAGATAAAGCCCATAAAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-565s21c1
Sequence:CCGGGGTTGTCAGACCGTTGTAAATCTCGAGATTTACAACGGTCTGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-802s21c1
Sequence:CCGGATGATTTCATGGTTACCATATCTCGAGATATGGTAACCATGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-535s21c1
Sequence:CCGGGAATTATCTGATGCCCTAAACCTCGAGGTTTAGGGCATCAGATAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-841s1c1
Sequence:CCGGGATGCCTTTATGGGCTTTATACTCGAGTATAAAGCCCATAAAGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-548s1c1
Sequence:CCGGCCCTAAACTGTATAGGAGGTTCTCGAGAACCTCCTATACAGTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-865s1c1
Sequence:CCGGCCTGCCTGTATTTATGAGATTCTCGAGAATCTCATAAATACAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-653s1c1
Sequence:CCGGGTAACATATTTCTTGTGGCTACTCGAGTAGCCACAAGAAATATGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-150s1c1
Sequence:CCGGCCTCCTGGTGATGATTTCAATCTCGAGATTGAAATCATCACCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175067
TAAR6 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-840s21c1
Sequence:CCGGTGATGCCTTTATGGGCTTTATCTCGAGATAAAGCCCATAAAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-565s21c1
Sequence:CCGGGGTTGTCAGACCGTTGTAAATCTCGAGATTTACAACGGTCTGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-802s21c1
Sequence:CCGGATGATTTCATGGTTACCATATCTCGAGATATGGTAACCATGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175067.1-535s21c1
Sequence:CCGGGAATTATCTGATGCCCTAAACCTCGAGGTTTAGGGCATCAGATAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-841s1c1
Sequence:CCGGGATGCCTTTATGGGCTTTATACTCGAGTATAAAGCCCATAAAGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-548s1c1
Sequence:CCGGCCCTAAACTGTATAGGAGGTTCTCGAGAACCTCCTATACAGTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-865s1c1
Sequence:CCGGCCTGCCTGTATTTATGAGATTCTCGAGAATCTCATAAATACAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-653s1c1
Sequence:CCGGGTAACATATTTCTTGTGGCTACTCGAGTAGCCACAAGAAATATGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175067.1-150s1c1
Sequence:CCGGCCTCCTGGTGATGATTTCAATCTCGAGATTGAAATCATCACCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136993
TAAR6 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-287s1c1
Sequence:CCGGGCTGCTGGTACTTTGGTAGAACTCGAGTTCTACCAAAGTACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-197s1c1
Sequence:CCGGCCACCAATTTCCTCATTGCATCTCGAGATGCAATGAGGAAATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-864s1c1
Sequence:CCGGCCCTGCCTACATTTATGAAATCTCGAGATTTCATAAATGTAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-290s1c1
Sequence:CCGGGCTGGTACTTTGGTAGAAGTTCTCGAGAACTTCTACCAAAGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136993
TAAR6 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-287s1c1
Sequence:CCGGGCTGCTGGTACTTTGGTAGAACTCGAGTTCTACCAAAGTACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-197s1c1
Sequence:CCGGCCACCAATTTCCTCATTGCATCTCGAGATGCAATGAGGAAATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-864s1c1
Sequence:CCGGCCCTGCCTACATTTATGAAATCTCGAGATTTCATAAATGTAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-290s1c1
Sequence:CCGGGCTGGTACTTTGGTAGAAGTTCTCGAGAACTTCTACCAAAGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136993
TAAR6 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-287s1c1
Sequence:CCGGGCTGCTGGTACTTTGGTAGAACTCGAGTTCTACCAAAGTACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-197s1c1
Sequence:CCGGCCACCAATTTCCTCATTGCATCTCGAGATGCAATGAGGAAATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-864s1c1
Sequence:CCGGCCCTGCCTACATTTATGAAATCTCGAGATTTCATAAATGTAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_136993.1-290s1c1
Sequence:CCGGGCTGGTACTTTGGTAGAAGTTCTCGAGAACTTCTACCAAAGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010828
TAAR6 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-623s21c1
Sequence:CCGGTACCTACACTTGTTATGATAACTCGAGTTATCATAACAAGTGTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-788s21c1
Sequence:CCGGCCGTGGTAGCATTCATGATATCTCGAGATATCATGAATGCTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-817s21c1
Sequence:CCGGCCCTACAGCATTGATTCATTACTCGAGTAATGAATCAATGCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-588s21c1
Sequence:CCGGGAACTGGGTGCTGATAGATTTCTCGAGAAATCTATCAGCACCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-522s21c1
Sequence:CCGGTGACGGCCTGGAGGAATTATCCTCGAGGATAATTCCTCCAGGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010828
TAAR6 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-623s21c1
Sequence:CCGGTACCTACACTTGTTATGATAACTCGAGTTATCATAACAAGTGTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-788s21c1
Sequence:CCGGCCGTGGTAGCATTCATGATATCTCGAGATATCATGAATGCTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-817s21c1
Sequence:CCGGCCCTACAGCATTGATTCATTACTCGAGTAATGAATCAATGCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-588s21c1
Sequence:CCGGGAACTGGGTGCTGATAGATTTCTCGAGAAATCTATCAGCACCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-522s21c1
Sequence:CCGGTGACGGCCTGGAGGAATTATCCTCGAGGATAATTCCTCCAGGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010828
TAAR6 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-623s21c1
Sequence:CCGGTACCTACACTTGTTATGATAACTCGAGTTATCATAACAAGTGTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-788s21c1
Sequence:CCGGCCGTGGTAGCATTCATGATATCTCGAGATATCATGAATGCTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-817s21c1
Sequence:CCGGCCCTACAGCATTGATTCATTACTCGAGTAATGAATCAATGCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-588s21c1
Sequence:CCGGGAACTGGGTGCTGATAGATTTCTCGAGAAATCTATCAGCACCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010828.1-522s21c1
Sequence:CCGGTGACGGCCTGGAGGAATTATCCTCGAGGATAATTCCTCCAGGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks