EMAIL THIS PAGE TO A FRIEND

TAAR9

trace amine associated receptor 9 (gene/pseudogene)

Synonyms: TA3 TAR3 TAR9 TRAR3
UniProtKB ID: Q96RI9
Gene ID:
Human(134860) Summary: TAAR9 is a member of a large family of rhodopsin G protein-coupled receptors (GPCRs, or GPRs). GPCRs contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Jul 2005]
Mouse(503558) trace amine-associated receptor 9
Rat(319107) trace amine-associated receptor 9
domestic guinea pig(100725833) trace amine associated receptor 9
naked mole-rat(101704790) trace amine associated receptor 9
cow(785334) trace amine associated receptor 9
sheep(101101992) trace amine associated receptor 9
domestic cat(101101059) trace amine associated receptor 9
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001010831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001010831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001010831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175057 Rosetta Predictions human pricing
NM_175602 Rosetta Predictions rat pricing
NM_001010831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200527 predicted 663
2 SASI_Hs01_00200529 predicted 630
3 SASI_Hs01_00200530 predicted 531
4 SASI_Hs01_00200531 predicted 617
5 SASI_Hs01_00200532 predicted 432
6 SASI_Hs01_00200533 predicted 711
7 SASI_Hs01_00200534 predicted 716
8 SASI_Hs01_00200535 predicted 271
9 SASI_Hs01_00200536 predicted 677
10 SASI_Hs02_00368956 predicted 301
11 SASI_Hs01_00200528 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091640 predicted 594
2 SASI_Rn01_00091641 predicted 608
3 SASI_Rn01_00091643 predicted 545
4 SASI_Rn01_00091644 predicted 281
5 SASI_Rn01_00091645 predicted 548
6 SASI_Rn01_00091646 predicted 403
7 SASI_Rn01_00091648 predicted 782
8 SASI_Rn01_00091649 predicted 376
9 SASI_Rn02_00269500 predicted 340
10 SASI_Rn02_00269501 predicted 288
11 SASI_Rn01_00091642 predicted 304
12 SASI_Rn01_00091647 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023639 predicted 681
2 SASI_Mm01_00023640 predicted 370
3 SASI_Mm01_00023641 predicted 663
4 SASI_Mm01_00023642 predicted 639
5 SASI_Mm01_00023643 predicted 717
6 SASI_Mm01_00023644 predicted 419
7 SASI_Mm01_00023645 predicted 302
8 SASI_Mm01_00023646 predicted 808
9 SASI_Mm01_00023647 predicted 385
10 SASI_Mm01_00023648 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175057
TAAR9 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 9 (gene/pseudogene)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-148s21c1
Sequence:CCGGGAAACTTACTGGTCATGATTGCTCGAGCAATCATGACCAGTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-54s21c1
Sequence:CCGGGTGAACGAATCCTGCATTAAACTCGAGTTTAATGCAGGATTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-833s21c1
Sequence:CCGGTGCAGTGATTGATGCTTATATCTCGAGATATAAGCATCAATCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-865s1c1
Sequence:CCGGCCTCCTTATGTTTATGAGATTCTCGAGAATCTCATAAACATAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-51s1c1
Sequence:CCGGCGTGAACGAATCCTGCATTAACTCGAGTTAATGCAGGATTCGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-36s1c1
Sequence:CCGGGCTGTGTTACAAGAACGTGAACTCGAGTTCACGTTCTTGTAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-635s1c1
Sequence:CCGGCCATGGTGTTTATATACAGTACTCGAGTACTGTATATAAACACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-371s1c1
Sequence:CCGGGCTGTATCTCTGTTGATAGATCTCGAGATCTATCAACAGAGATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175057
TAAR9 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 9 (gene/pseudogene)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-148s21c1
Sequence:CCGGGAAACTTACTGGTCATGATTGCTCGAGCAATCATGACCAGTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-54s21c1
Sequence:CCGGGTGAACGAATCCTGCATTAAACTCGAGTTTAATGCAGGATTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-833s21c1
Sequence:CCGGTGCAGTGATTGATGCTTATATCTCGAGATATAAGCATCAATCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-865s1c1
Sequence:CCGGCCTCCTTATGTTTATGAGATTCTCGAGAATCTCATAAACATAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-51s1c1
Sequence:CCGGCGTGAACGAATCCTGCATTAACTCGAGTTAATGCAGGATTCGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-36s1c1
Sequence:CCGGGCTGTGTTACAAGAACGTGAACTCGAGTTCACGTTCTTGTAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-635s1c1
Sequence:CCGGCCATGGTGTTTATATACAGTACTCGAGTACTGTATATAAACACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-371s1c1
Sequence:CCGGGCTGTATCTCTGTTGATAGATCTCGAGATCTATCAACAGAGATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175057
TAAR9 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 9 (gene/pseudogene)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-148s21c1
Sequence:CCGGGAAACTTACTGGTCATGATTGCTCGAGCAATCATGACCAGTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-54s21c1
Sequence:CCGGGTGAACGAATCCTGCATTAAACTCGAGTTTAATGCAGGATTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175057.3-833s21c1
Sequence:CCGGTGCAGTGATTGATGCTTATATCTCGAGATATAAGCATCAATCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-865s1c1
Sequence:CCGGCCTCCTTATGTTTATGAGATTCTCGAGAATCTCATAAACATAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-51s1c1
Sequence:CCGGCGTGAACGAATCCTGCATTAACTCGAGTTAATGCAGGATTCGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-36s1c1
Sequence:CCGGGCTGTGTTACAAGAACGTGAACTCGAGTTCACGTTCTTGTAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-635s1c1
Sequence:CCGGCCATGGTGTTTATATACAGTACTCGAGTACTGTATATAAACACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175057.1-371s1c1
Sequence:CCGGGCTGTATCTCTGTTGATAGATCTCGAGATCTATCAACAGAGATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010831
TAAR9 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 9 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-820s21c1
Sequence:CCGGTACATTATTGATGCGGTTATTCTCGAGAATAACCGCATCAATAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-146s21c1
Sequence:CCGGGGAACTTACTGGTCATCATTGCTCGAGCAATGATGACCAGTAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-52s21c1
Sequence:CCGGGTGAACGGATCCTGCATTAAACTCGAGTTTAATGCAGGATCCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-313s21c1
Sequence:CCGGTGTAAGTTCCACACGTGTTTCCTCGAGGAAACACGTGTGGAACTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-349s21c1
Sequence:CCGGTTTGCGTCTCTGTTTCATTTACTCGAGTAAATGAAACAGAGACGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-727s1c1
Sequence:CCGGGAGAGCTATAAGGAAAGAGTACTCGAGTACTCTTTCCTTATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-640s1c1
Sequence:CCGGGTGTTTCTATATGGTCGGATACTCGAGTATCCGACCATATAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-731s1c1
Sequence:CCGGGCTATAAGGAAAGAGTAGCCACTCGAGTGGCTACTCTTTCCTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-852s1c1
Sequence:CCGGGAACTTCATAACTCCTGCGTACTCGAGTACGCAGGAGTTATGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010831
TAAR9 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 9 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-820s21c1
Sequence:CCGGTACATTATTGATGCGGTTATTCTCGAGAATAACCGCATCAATAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-146s21c1
Sequence:CCGGGGAACTTACTGGTCATCATTGCTCGAGCAATGATGACCAGTAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-52s21c1
Sequence:CCGGGTGAACGGATCCTGCATTAAACTCGAGTTTAATGCAGGATCCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-313s21c1
Sequence:CCGGTGTAAGTTCCACACGTGTTTCCTCGAGGAAACACGTGTGGAACTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-349s21c1
Sequence:CCGGTTTGCGTCTCTGTTTCATTTACTCGAGTAAATGAAACAGAGACGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-727s1c1
Sequence:CCGGGAGAGCTATAAGGAAAGAGTACTCGAGTACTCTTTCCTTATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-640s1c1
Sequence:CCGGGTGTTTCTATATGGTCGGATACTCGAGTATCCGACCATATAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-731s1c1
Sequence:CCGGGCTATAAGGAAAGAGTAGCCACTCGAGTGGCTACTCTTTCCTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-852s1c1
Sequence:CCGGGAACTTCATAACTCCTGCGTACTCGAGTACGCAGGAGTTATGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010831
TAAR9 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 9 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-820s21c1
Sequence:CCGGTACATTATTGATGCGGTTATTCTCGAGAATAACCGCATCAATAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-146s21c1
Sequence:CCGGGGAACTTACTGGTCATCATTGCTCGAGCAATGATGACCAGTAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-52s21c1
Sequence:CCGGGTGAACGGATCCTGCATTAAACTCGAGTTTAATGCAGGATCCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-313s21c1
Sequence:CCGGTGTAAGTTCCACACGTGTTTCCTCGAGGAAACACGTGTGGAACTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010831.1-349s21c1
Sequence:CCGGTTTGCGTCTCTGTTTCATTTACTCGAGTAAATGAAACAGAGACGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-727s1c1
Sequence:CCGGGAGAGCTATAAGGAAAGAGTACTCGAGTACTCTTTCCTTATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-640s1c1
Sequence:CCGGGTGTTTCTATATGGTCGGATACTCGAGTATCCGACCATATAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-731s1c1
Sequence:CCGGGCTATAAGGAAAGAGTAGCCACTCGAGTGGCTACTCTTTCCTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010831.1-852s1c1
Sequence:CCGGGAACTTCATAACTCCTGCGTACTCGAGTACGCAGGAGTTATGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks