EMAIL THIS PAGE TO A FRIEND

TAB1

TGF-beta activated kinase 1/MAP3K7 binding protein 1

Synonyms: 3'-Tab1 MAP3K7IP1
UniProtKB ID: Q15750, Q2PP09, Q8IZW2
Gene ID:
Human(10454) Summary: The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(66513) TGF-beta activated kinase 1/MAP3K7 binding protein 1
Rat(315139) TGF-beta activated kinase 1/MAP3K7 binding protein 1
Zebrafish(403084) TGF-beta activated kinase 1/MAP3K7 binding protein 1
chicken(418014) TGF-beta activated kinase 1/MAP3K7 binding protein 1
dog(481245) TGF-beta activated kinase 1/MAP3K7 binding protein 1
domestic cat(101083606) TGF-beta activated kinase 1/MAP3K7 binding protein 1
cow(519958) TGF-beta activated kinase 1/MAP3K7 binding protein 1
sheep(101122943) TGF-beta activated kinase 1/MAP3K7 binding protein 1
naked mole-rat(101696480) TGF-beta activated kinase 1/MAP3K7 binding protein 1
Domestic Rabbit(100358246) TGF-beta activated kinase 1/MAP3K7 binding protein 1
domestic guinea pig(100735373) TGF-beta activated kinase 1/MAP3K7 binding protein 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M9196 Anti-MAP3K7IP1 (241-255) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M9321 Anti-MAP3K7IP1 (31-44) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406993 Anti-MAP3K7IP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103742 Anti-MAP3K7IP1, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rat, human, guinea pig, rabbit
western blot pricing
SAB1306020 ANTI-MAP3K7IP1-S423 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1105223 Anti-phospho-MAP3K7IP1 (pSer438) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
PRS3387 Anti-TAB1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
HPA039988 Anti-TAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA057104 Anti-TAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4301002 Anti-TAB1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0010454M3 Monoclonal Anti-MAP3K7IP1 antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB1404829 Monoclonal Anti-MAP3K7IP1 antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006116 Rosetta Predictions human pricing
NM_153497 Rosetta Predictions human pricing
NM_001109976 Rosetta Predictions rat pricing
XM_243623 Rosetta Predictions rat pricing
NM_025609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340933 predicted 821
2 SASI_Hs01_00094398 predicted 205
3 SASI_Hs01_00094399 predicted 589
4 SASI_Hs02_00340934 predicted 217
5 SASI_Hs01_00094400 predicted 963
6 SASI_Hs01_00094401 predicted 440
7 SASI_Hs01_00094402 predicted 253
8 SASI_Hs01_00094403 predicted 551
9 SASI_Hs01_00094404 predicted 974
10 SASI_Hs01_00094407 predicted 1109
11 SASI_Hs01_00094405 predicted 519
12 SASI_Hs01_00094406 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367317 predicted 819
2 SASI_Hs01_00021220 predicted 202
3 SASI_Hs01_00021221 predicted 596
4 SASI_Hs02_00367318 predicted 222
5 SASI_Hs01_00021222 predicted 960
6 SASI_Hs01_00021223 predicted 440
7 SASI_Hs01_00021224 predicted 248
8 SASI_Hs01_00021225 predicted 549
9 SASI_Hs01_00021226 predicted 976
10 SASI_Hs01_00021229 predicted 1110
11 SASI_Hs01_00021227 predicted 515
12 SASI_Hs01_00021228 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250932 predicted 1099
2 SASI_Rn02_00250933 predicted 943
3 SASI_Rn02_00250934 predicted 1989
4 SASI_Rn02_00250935 predicted 1935
5 SASI_Rn02_00250936 predicted 300
6 SASI_Rn02_00250937 predicted 1010
7 SASI_Rn02_00250938 predicted 368
8 SASI_Rn02_00250939 predicted 508
9 SASI_Rn02_00250940 predicted 1060
10 SASI_Rn02_00250941 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174073 predicted 209
2 SASI_Rn01_00174074 predicted 211
3 SASI_Rn01_00174075 predicted 232
4 SASI_Rn01_00174076 predicted 310
5 SASI_Rn01_00174077 predicted 246
6 SASI_Rn01_00174078 predicted 301
7 SASI_Rn01_00174079 predicted 229
8 SASI_Rn01_00174080 predicted 306
9 SASI_Rn01_00174081 predicted 235
10 SASI_Rn01_00174082 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163887 predicted 352
2 SASI_Mm01_00163888 predicted 1493
3 SASI_Mm01_00163889 predicted 636
4 SASI_Mm01_00163890 predicted 1080
5 SASI_Mm01_00163891 predicted 998
6 SASI_Mm01_00163892 predicted 1426
7 SASI_Mm01_00163893 predicted 920
8 SASI_Mm02_00328642 predicted 1499
9 SASI_Mm01_00163896 predicted 599
10 SASI_Mm02_00328643 predicted 787
11 SASI_Mm01_00163894 predicted 237
12 SASI_Mm01_00163895 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006116
VALIDATED
TAB1 MISSION shRNA Bacterial Glycerol Stock
TGF-beta activated kinase 1/MAP3K7 binding protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-2506s1c1
Sequence:CCGGCCTTTGAGACACAGTAACCCTCTCGAGAGGGTTACTGTGTCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-797s1c1
Sequence:CCGGCGCTGCCAAGTCCAAACCAATCTCGAGATTGGTTTGGACTTGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-452s1c1
Sequence:CCGGGCCTCCTCAGTATCAGAAGATCTCGAGATCTTCTGATACTGAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-951s1c1
Sequence:CCGGGCGATGATTGACACTGAGTTTCTCGAGAAACTCAGTGTCAATCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006116.x-1452s1c1
Sequence:CCGGGTTGAGCCCTATGTGGACTTTCTCGAGAAAGTCCACATAGGGCTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006116.2-1728s21c1
Sequence:GTACCGGGACTGGACCTGTGGTTCATACCTCGAGGTATGAACCACAGGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-1353s21c1
Sequence:GTACCGGCCAACCAAAGCCCGACCTTAACTCGAGTTAAGGTCGGGCTTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-685s21c1
Sequence:CCGGGGATGAGCTCTTCCGTCTTTCCTCGAGGAAAGACGGAAGAGCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-587s21c1
Sequence:CCGGGTCGCCAATGTCGGTACAAACCTCGAGGTTTGTACCGACATTGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-481s21c1
Sequence:CCGGGCCTCCTCAGTATCAGAAGATCTCGAGATCTTCTGATACTGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-826s21c1
Sequence:CCGGCGCTGCCAAGTCCAAACCAATCTCGAGATTGGTTTGGACTTGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-516s21c1
Sequence:GTACCGGAGACGTTAGAGAGGGAAATTTCTCGAGAAATTTCCCTCTCTAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006116
VALIDATED
TAB1 MISSION shRNA shRNA Plasmid DNA
TGF-beta activated kinase 1/MAP3K7 binding protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-2506s1c1
Sequence:CCGGCCTTTGAGACACAGTAACCCTCTCGAGAGGGTTACTGTGTCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-797s1c1
Sequence:CCGGCGCTGCCAAGTCCAAACCAATCTCGAGATTGGTTTGGACTTGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-452s1c1
Sequence:CCGGGCCTCCTCAGTATCAGAAGATCTCGAGATCTTCTGATACTGAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-951s1c1
Sequence:CCGGGCGATGATTGACACTGAGTTTCTCGAGAAACTCAGTGTCAATCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006116.x-1452s1c1
Sequence:CCGGGTTGAGCCCTATGTGGACTTTCTCGAGAAAGTCCACATAGGGCTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006116.2-1728s21c1
Sequence:GTACCGGGACTGGACCTGTGGTTCATACCTCGAGGTATGAACCACAGGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-1353s21c1
Sequence:GTACCGGCCAACCAAAGCCCGACCTTAACTCGAGTTAAGGTCGGGCTTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-685s21c1
Sequence:CCGGGGATGAGCTCTTCCGTCTTTCCTCGAGGAAAGACGGAAGAGCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-587s21c1
Sequence:CCGGGTCGCCAATGTCGGTACAAACCTCGAGGTTTGTACCGACATTGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-481s21c1
Sequence:CCGGGCCTCCTCAGTATCAGAAGATCTCGAGATCTTCTGATACTGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-826s21c1
Sequence:CCGGCGCTGCCAAGTCCAAACCAATCTCGAGATTGGTTTGGACTTGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-516s21c1
Sequence:GTACCGGAGACGTTAGAGAGGGAAATTTCTCGAGAAATTTCCCTCTCTAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006116
VALIDATED
TAB1 MISSION shRNA Lentiviral Transduction Particles
TGF-beta activated kinase 1/MAP3K7 binding protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-2506s1c1
Sequence:CCGGCCTTTGAGACACAGTAACCCTCTCGAGAGGGTTACTGTGTCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-797s1c1
Sequence:CCGGCGCTGCCAAGTCCAAACCAATCTCGAGATTGGTTTGGACTTGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-452s1c1
Sequence:CCGGGCCTCCTCAGTATCAGAAGATCTCGAGATCTTCTGATACTGAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006116.x-951s1c1
Sequence:CCGGGCGATGATTGACACTGAGTTTCTCGAGAAACTCAGTGTCAATCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006116.x-1452s1c1
Sequence:CCGGGTTGAGCCCTATGTGGACTTTCTCGAGAAAGTCCACATAGGGCTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006116.2-1728s21c1
Sequence:GTACCGGGACTGGACCTGTGGTTCATACCTCGAGGTATGAACCACAGGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-1353s21c1
Sequence:GTACCGGCCAACCAAAGCCCGACCTTAACTCGAGTTAAGGTCGGGCTTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-685s21c1
Sequence:CCGGGGATGAGCTCTTCCGTCTTTCCTCGAGGAAAGACGGAAGAGCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-587s21c1
Sequence:CCGGGTCGCCAATGTCGGTACAAACCTCGAGGTTTGTACCGACATTGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-481s21c1
Sequence:CCGGGCCTCCTCAGTATCAGAAGATCTCGAGATCTTCTGATACTGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-826s21c1
Sequence:CCGGCGCTGCCAAGTCCAAACCAATCTCGAGATTGGTTTGGACTTGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006116.2-516s21c1
Sequence:GTACCGGAGACGTTAGAGAGGGAAATTTCTCGAGAAATTTCCCTCTCTAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025609
VALIDATED
TAB1 MISSION shRNA Bacterial Glycerol Stock
TGF-beta activated kinase 1/MAP3K7 binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025609.2-2598s1c1
Sequence:CCGGGCCCTTCCATCAGGATTAAATCTCGAGATTTAATCCTGATGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-933s1c1
Sequence:CCGGGCGATGATTGACACCGAGTTTCTCGAGAAACTCGGTGTCAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-438s1c1
Sequence:CCGGCCTCAGTACCAGAAGATCCTTCTCGAGAAGGATCTTCTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-1099s1c1
Sequence:CCGGGCTATCCATTGGGTGAAATGACTCGAGTCATTTCACCCAATGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-593s1c1
Sequence:CCGGGTTACAGGTTACACAGCTAAACTCGAGTTTAGCTGTGTAACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025609.2-2598s21c1
Sequence:CCGGGCCCTTCCATCAGGATTAAATCTCGAGATTTAATCCTGATGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-438s21c1
Sequence:CCGGCCTCAGTACCAGAAGATCCTTCTCGAGAAGGATCTTCTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-593s21c1
Sequence:CCGGGTTACAGGTTACACAGCTAAACTCGAGTTTAGCTGTGTAACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-933s21c1
Sequence:CCGGGCGATGATTGACACCGAGTTTCTCGAGAAACTCGGTGTCAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025609
VALIDATED
TAB1 MISSION shRNA shRNA Plasmid DNA
TGF-beta activated kinase 1/MAP3K7 binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025609.2-2598s1c1
Sequence:CCGGGCCCTTCCATCAGGATTAAATCTCGAGATTTAATCCTGATGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-933s1c1
Sequence:CCGGGCGATGATTGACACCGAGTTTCTCGAGAAACTCGGTGTCAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-438s1c1
Sequence:CCGGCCTCAGTACCAGAAGATCCTTCTCGAGAAGGATCTTCTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-1099s1c1
Sequence:CCGGGCTATCCATTGGGTGAAATGACTCGAGTCATTTCACCCAATGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-593s1c1
Sequence:CCGGGTTACAGGTTACACAGCTAAACTCGAGTTTAGCTGTGTAACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025609.2-2598s21c1
Sequence:CCGGGCCCTTCCATCAGGATTAAATCTCGAGATTTAATCCTGATGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-438s21c1
Sequence:CCGGCCTCAGTACCAGAAGATCCTTCTCGAGAAGGATCTTCTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-593s21c1
Sequence:CCGGGTTACAGGTTACACAGCTAAACTCGAGTTTAGCTGTGTAACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-933s21c1
Sequence:CCGGGCGATGATTGACACCGAGTTTCTCGAGAAACTCGGTGTCAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025609
VALIDATED
TAB1 MISSION shRNA Lentiviral Transduction Particles
TGF-beta activated kinase 1/MAP3K7 binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025609.2-2598s1c1
Sequence:CCGGGCCCTTCCATCAGGATTAAATCTCGAGATTTAATCCTGATGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-933s1c1
Sequence:CCGGGCGATGATTGACACCGAGTTTCTCGAGAAACTCGGTGTCAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-438s1c1
Sequence:CCGGCCTCAGTACCAGAAGATCCTTCTCGAGAAGGATCTTCTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-1099s1c1
Sequence:CCGGGCTATCCATTGGGTGAAATGACTCGAGTCATTTCACCCAATGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025609.2-593s1c1
Sequence:CCGGGTTACAGGTTACACAGCTAAACTCGAGTTTAGCTGTGTAACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025609.2-2598s21c1
Sequence:CCGGGCCCTTCCATCAGGATTAAATCTCGAGATTTAATCCTGATGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-438s21c1
Sequence:CCGGCCTCAGTACCAGAAGATCCTTCTCGAGAAGGATCTTCTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-593s21c1
Sequence:CCGGGTTACAGGTTACACAGCTAAACTCGAGTTTAGCTGTGTAACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025609.2-933s21c1
Sequence:CCGGGCGATGATTGACACCGAGTTTCTCGAGAAACTCGGTGTCAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks