EMAIL THIS PAGE TO A FRIEND

TAB2

TGF-beta activated kinase 1/MAP3K7 binding protein 2

Synonyms: CHTD2 MAP3K7IP2
Gene ID:
Human(23118) Summary: The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, thus serves as an adaptor linking MAP3K7 and TRAF6. This protein, TAB1, and MAP3K7 also participate in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. [provided by RefSeq, Jul 2008]
Mouse(68652) TGF-beta activated kinase 1/MAP3K7 binding protein 2
Rat(308267) TGF-beta activated kinase 1/MAP3K7 binding protein 2
domestic guinea pig(100717911) TGF-beta activated kinase 1/MAP3K7 binding protein 2
naked mole-rat(101698406) TGF-beta activated kinase 1/MAP3K7 binding protein 2
cow(540203) TGF-beta activated kinase 1/MAP3K7 binding protein 2
sheep(101122114) TGF-beta activated kinase 1/MAP3K7 binding protein 2
fruit fly(37216) TAK1-associated binding protein 2
Horse(100060433) TGF-beta activated kinase 1/MAP3K7 binding protein 2
domestic cat(101098714) TGF-beta activated kinase 1/MAP3K7 binding protein 2
dog(484028) TGF-beta activated kinase 1/MAP3K7 binding protein 2
Zebrafish(494163) TGF-beta activated kinase 1/MAP3K7 binding protein 2
chicken(421622) TGF-beta activated kinase 1/MAP3K7 binding protein 2
264 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015093 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015093 Rosetta Predictions human pricing
NM_001012062 Rosetta Predictions rat pricing
XM_574265 Rosetta Predictions rat pricing
NM_138667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089730 predicted 1986
2 SASI_Hs01_00089731 predicted 486
3 SASI_Hs01_00089732 predicted 500
4 SASI_Hs01_00089734 predicted 1919
5 SASI_Hs02_00346977 predicted 385
6 SASI_Hs01_00089735 predicted 2258
7 SASI_Hs01_00089736 predicted 365
8 SASI_Hs01_00089737 predicted 805
9 SASI_Hs01_00089738 predicted 1373
10 SASI_Hs02_00346978 predicted 1248
11 SASI_Hs01_00089733 predicted 1618
12 SASI_Hs01_00089739 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117325 predicted 801
2 SASI_Rn02_00200166 predicted 1944
3 SASI_Rn01_00117326 predicted 1978
4 SASI_Rn01_00117327 predicted 2044
5 SASI_Rn01_00117328 predicted 1254
6 SASI_Rn01_00117329 predicted 673
7 SASI_Rn01_00117330 predicted 464
8 SASI_Rn01_00117331 predicted 931
9 SASI_Rn01_00117332 predicted 1913
10 SASI_Rn01_00117333 predicted 497
11 SASI_Rn01_00117334 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127984 predicted 808
2 SASI_Rn01_00127985 predicted 658
3 SASI_Rn01_00127986 predicted 1254
4 SASI_Rn01_00127987 predicted 674
5 SASI_Rn01_00127988 predicted 478
6 SASI_Rn01_00127989 predicted 940
7 SASI_Rn01_00127990 predicted 2276
8 SASI_Rn01_00127991 predicted 1378
9 SASI_Rn01_00127992 predicted 605
10 SASI_Rn01_00127993 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183111 predicted 594
2 SASI_Mm01_00183112 predicted 376
3 SASI_Mm02_00339735 predicted 1852
4 SASI_Mm01_00183114 predicted 1514
5 SASI_Mm01_00183115 predicted 364
6 SASI_Mm02_00339736 predicted 1883
7 SASI_Mm01_00183117 predicted 843
8 SASI_Mm01_00183118 predicted 627
9 SASI_Mm01_00183120 predicted 516
10 SASI_Mm02_00339737 predicted 719
11 SASI_Mm01_00183113 predicted 505
12 SASI_Mm01_00183116 predicted 2178
13 SASI_Mm01_00183119 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015093
VALIDATED
TAB2 MISSION shRNA Bacterial Glycerol Stock
TGF-beta activated kinase 1/MAP3K7 binding protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1096s21c1
Sequence:CCGGTTCTGCCCATAGCCAATATAACTCGAGTTATATTGGCTATGGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-729s21c1
Sequence:CCGGATATCCAGACTGGTCGTAATACTCGAGTATTACGACCAGTCTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1496s21c1
Sequence:CCGGAGTCGAGCAATAGGCAATAACCTCGAGGTTATTGCCTATTGCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1325s21c1
Sequence:CCGGAGTCAACCTAAGGTCTATATTCTCGAGAATATAGACCTTAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015093.3-1986s21c1
Sequence:CCGGAGATTGACATTGACTGCTTAACTCGAGTTAAGCAGTCAATGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1543s21c1
Sequence:CCGGCACTCAGCCCAATACGAAATACTCGAGTATTTCGTATTGGGCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-1983s1c1
Sequence:CCGGAGATTGACATTGACTGCTTAACTCGAGTTAAGCAGTCAATGTCAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-956s1c1
Sequence:CCGGGCATCTAATCCTCTGTCACATCTCGAGATGTGACAGAGGATTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-2264s1c1
Sequence:CCGGTGGCCCTGTATCTTCTCTAAACTCGAGTTTAGAGAAGATACAGGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015093.x-1463s1c1
Sequence:CCGGCCTGCCTTTATTCATCACCATCTCGAGATGGTGATGAATAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-236s1c1
Sequence:CCGGCCTGAAGTACCTGAAGTTGTTCTCGAGAACAACTTCAGGTACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015093
VALIDATED
TAB2 MISSION shRNA shRNA Plasmid DNA
TGF-beta activated kinase 1/MAP3K7 binding protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1096s21c1
Sequence:CCGGTTCTGCCCATAGCCAATATAACTCGAGTTATATTGGCTATGGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-729s21c1
Sequence:CCGGATATCCAGACTGGTCGTAATACTCGAGTATTACGACCAGTCTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1496s21c1
Sequence:CCGGAGTCGAGCAATAGGCAATAACCTCGAGGTTATTGCCTATTGCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1325s21c1
Sequence:CCGGAGTCAACCTAAGGTCTATATTCTCGAGAATATAGACCTTAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015093.3-1986s21c1
Sequence:CCGGAGATTGACATTGACTGCTTAACTCGAGTTAAGCAGTCAATGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1543s21c1
Sequence:CCGGCACTCAGCCCAATACGAAATACTCGAGTATTTCGTATTGGGCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-1983s1c1
Sequence:CCGGAGATTGACATTGACTGCTTAACTCGAGTTAAGCAGTCAATGTCAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-956s1c1
Sequence:CCGGGCATCTAATCCTCTGTCACATCTCGAGATGTGACAGAGGATTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-2264s1c1
Sequence:CCGGTGGCCCTGTATCTTCTCTAAACTCGAGTTTAGAGAAGATACAGGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015093.x-1463s1c1
Sequence:CCGGCCTGCCTTTATTCATCACCATCTCGAGATGGTGATGAATAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-236s1c1
Sequence:CCGGCCTGAAGTACCTGAAGTTGTTCTCGAGAACAACTTCAGGTACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015093
VALIDATED
TAB2 MISSION shRNA Lentiviral Transduction Particles
TGF-beta activated kinase 1/MAP3K7 binding protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1096s21c1
Sequence:CCGGTTCTGCCCATAGCCAATATAACTCGAGTTATATTGGCTATGGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-729s21c1
Sequence:CCGGATATCCAGACTGGTCGTAATACTCGAGTATTACGACCAGTCTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1496s21c1
Sequence:CCGGAGTCGAGCAATAGGCAATAACCTCGAGGTTATTGCCTATTGCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1325s21c1
Sequence:CCGGAGTCAACCTAAGGTCTATATTCTCGAGAATATAGACCTTAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015093.3-1986s21c1
Sequence:CCGGAGATTGACATTGACTGCTTAACTCGAGTTAAGCAGTCAATGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015093.3-1543s21c1
Sequence:CCGGCACTCAGCCCAATACGAAATACTCGAGTATTTCGTATTGGGCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-1983s1c1
Sequence:CCGGAGATTGACATTGACTGCTTAACTCGAGTTAAGCAGTCAATGTCAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-956s1c1
Sequence:CCGGGCATCTAATCCTCTGTCACATCTCGAGATGTGACAGAGGATTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-2264s1c1
Sequence:CCGGTGGCCCTGTATCTTCTCTAAACTCGAGTTTAGAGAAGATACAGGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015093.x-1463s1c1
Sequence:CCGGCCTGCCTTTATTCATCACCATCTCGAGATGGTGATGAATAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015093.x-236s1c1
Sequence:CCGGCCTGAAGTACCTGAAGTTGTTCTCGAGAACAACTTCAGGTACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138667
VALIDATED
TAB2 MISSION shRNA Bacterial Glycerol Stock
TGF-beta activated kinase 1/MAP3K7 binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-1556s21c1
Sequence:CCGGAGTCAACCCAAGGTCTATATTCTCGAGAATATAGACCTTGGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-2133s21c1
Sequence:CCGGGGCGCCTGAAGAGATCAAATTCTCGAGAATTTGATCTCTTCAGGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138667.3-1327s21c1
Sequence:CCGGTTCTGCCCATAGCCAATATAACTCGAGTTATATTGGCTATGGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-2639s21c1
Sequence:CCGGCTAATGATACCTCAATCTAATCTCGAGATTAGATTGAGGTATCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138667.3-1370s21c1
Sequence:CCGGCCTCGAAAGAACCAGATAGAACTCGAGTTCTATCTGGTTCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138667.1-421s1c1
Sequence:CCGGGCAGTCCAATAACGAACTGTTCTCGAGAACAGTTCGTTATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-1037s1c1
Sequence:CCGGCCTCGAAAGAACCAGATAGAACTCGAGTTCTATCTGGTTCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138667.1-2090s1c1
Sequence:CCGGGCCTGTACGTTTCTGAATCATCTCGAGATGATTCAGAAACGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-2654s1c1
Sequence:CCGGGCCAGCATTTAGGTGTGAGATCTCGAGATCTCACACCTAAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-1852s1c1
Sequence:CCGGGCAGCAGTTGAGAAGTTGTAACTCGAGTTACAACTTCTCAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138667
VALIDATED
TAB2 MISSION shRNA shRNA Plasmid DNA
TGF-beta activated kinase 1/MAP3K7 binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-1556s21c1
Sequence:CCGGAGTCAACCCAAGGTCTATATTCTCGAGAATATAGACCTTGGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-2133s21c1
Sequence:CCGGGGCGCCTGAAGAGATCAAATTCTCGAGAATTTGATCTCTTCAGGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138667.3-1327s21c1
Sequence:CCGGTTCTGCCCATAGCCAATATAACTCGAGTTATATTGGCTATGGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-2639s21c1
Sequence:CCGGCTAATGATACCTCAATCTAATCTCGAGATTAGATTGAGGTATCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138667.3-1370s21c1
Sequence:CCGGCCTCGAAAGAACCAGATAGAACTCGAGTTCTATCTGGTTCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138667.1-421s1c1
Sequence:CCGGGCAGTCCAATAACGAACTGTTCTCGAGAACAGTTCGTTATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-1037s1c1
Sequence:CCGGCCTCGAAAGAACCAGATAGAACTCGAGTTCTATCTGGTTCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138667.1-2090s1c1
Sequence:CCGGGCCTGTACGTTTCTGAATCATCTCGAGATGATTCAGAAACGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-2654s1c1
Sequence:CCGGGCCAGCATTTAGGTGTGAGATCTCGAGATCTCACACCTAAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-1852s1c1
Sequence:CCGGGCAGCAGTTGAGAAGTTGTAACTCGAGTTACAACTTCTCAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138667
VALIDATED
TAB2 MISSION shRNA Lentiviral Transduction Particles
TGF-beta activated kinase 1/MAP3K7 binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-1556s21c1
Sequence:CCGGAGTCAACCCAAGGTCTATATTCTCGAGAATATAGACCTTGGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-2133s21c1
Sequence:CCGGGGCGCCTGAAGAGATCAAATTCTCGAGAATTTGATCTCTTCAGGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138667.3-1327s21c1
Sequence:CCGGTTCTGCCCATAGCCAATATAACTCGAGTTATATTGGCTATGGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138667.3-2639s21c1
Sequence:CCGGCTAATGATACCTCAATCTAATCTCGAGATTAGATTGAGGTATCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138667.3-1370s21c1
Sequence:CCGGCCTCGAAAGAACCAGATAGAACTCGAGTTCTATCTGGTTCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138667.1-421s1c1
Sequence:CCGGGCAGTCCAATAACGAACTGTTCTCGAGAACAGTTCGTTATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-1037s1c1
Sequence:CCGGCCTCGAAAGAACCAGATAGAACTCGAGTTCTATCTGGTTCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138667.1-2090s1c1
Sequence:CCGGGCCTGTACGTTTCTGAATCATCTCGAGATGATTCAGAAACGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-2654s1c1
Sequence:CCGGGCCAGCATTTAGGTGTGAGATCTCGAGATCTCACACCTAAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138667.1-1852s1c1
Sequence:CCGGGCAGCAGTTGAGAAGTTGTAACTCGAGTTACAACTTCTCAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks