EMAIL THIS PAGE TO A FRIEND

TAB3

TGF-beta activated kinase 1/MAP3K7 binding protein 3

Synonyms: MAP3K7IP3 NAP1
UniProtKB ID: Q8N5C8, A6NDD9, Q6VQR0
Gene ID:
Human(257397) Summary: The product of this gene functions in the NF-kappaB signal transduction pathway. The encoded protein, and the similar and functionally redundant protein MAP3K7IP2/TAB2, forms a ternary complex with the protein kinase MAP3K7/TAK1 and either TRAF2 or TRAF6 in response to stimulation with the pro-inflammatory cytokines TNF or IL-1. Subsequent MAP3K7/TAK1 kinase activity triggers a signaling cascade leading to activation of the NF-kappaB transcription factor. The human genome contains a related pseudogene. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(66724) TGF-beta activated kinase 1/MAP3K7 binding protein 3
Rat(317546) TGF-beta activated kinase 1/MAP3K7 binding protein 3
Zebrafish(566547) TGF-beta activated kinase 1/MAP3K7 binding protein 3
Horse(100051087) TGF-beta activated kinase 1/MAP3K7 binding protein 3
domestic cat(101101545) TGF-beta activated kinase 1/MAP3K7 binding protein 3
dog(491807) TGF-beta activated kinase 1/MAP3K7 binding protein 3
chicken(418588) TGF-beta activated kinase 1/MAP3K7 binding protein 3
cow(788288) TGF-beta activated kinase 1/MAP3K7 binding protein 3
sheep(101119184) TGF-beta activated kinase 1/MAP3K7 binding protein 3
naked mole-rat(101718111) TGF-beta activated kinase 1/MAP3K7 binding protein 3
domestic guinea pig(100726447) TGF-beta activated kinase 1/MAP3K7 binding protein 3
288 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152787 Rosetta Predictions human pricing
XM_001055457 Rosetta Predictions rat pricing
XM_001055511 Rosetta Predictions rat pricing
XR_005973 Rosetta Predictions rat pricing
NM_025729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366730 predicted 1899
2 SASI_Hs01_00071854 predicted 2406
3 SASI_Hs01_00071855 predicted 1777
4 SASI_Hs02_00366731 predicted 1158
5 SASI_Hs01_00071856 predicted 1328
6 SASI_Hs01_00071857 predicted 1840
7 SASI_Hs01_00071859 predicted 1890
8 SASI_Hs01_00071860 predicted 1214
9 SASI_Hs01_00071861 predicted 1716
10 SASI_Hs01_00071862 predicted 2729
11 SASI_Hs01_00071853 predicted 1760
12 SASI_Hs01_00071858 predicted 2463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279592 predicted 1113
2 SASI_Rn02_00279593 predicted 604
3 SASI_Rn02_00279594 predicted 1369
4 SASI_Rn02_00279595 predicted 2024
5 SASI_Rn02_00279596 predicted 1800
6 SASI_Rn02_00279597 predicted 564
7 SASI_Rn02_00279598 predicted 881
8 SASI_Rn02_00279599 predicted 1503
9 SASI_Rn02_00279600 predicted 923
10 SASI_Rn02_00279601 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279801 predicted 1118
2 SASI_Rn02_00279802 predicted 607
3 SASI_Rn02_00279803 predicted 1373
4 SASI_Rn02_00279804 predicted 2023
5 SASI_Rn02_00279805 predicted 1800
6 SASI_Rn02_00279806 predicted 566
7 SASI_Rn02_00279807 predicted 884
8 SASI_Rn02_00279808 predicted 1502
9 SASI_Rn02_00279809 predicted 924
10 SASI_Rn02_00279810 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171487 predicted 762
2 SASI_Rn01_00171488 predicted 251
3 SASI_Rn01_00171489 predicted 1018
4 SASI_Rn01_00171491 predicted 1581
5 SASI_Rn01_00171492 predicted 1352
6 SASI_Rn01_00171493 predicted 213
7 SASI_Rn01_00171494 predicted 1098
8 SASI_Rn01_00171495 predicted 534
9 SASI_Rn02_00410694 predicted 641
10 SASI_Rn01_00171496 predicted 567
11 SASI_Rn01_00171490 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141434 predicted 382
2 SASI_Mm01_00141435 predicted 1145
3 SASI_Mm01_00141436 predicted 1403
4 SASI_Mm01_00141437 predicted 2059
5 SASI_Mm01_00141438 predicted 520
6 SASI_Mm01_00141439 predicted 2474
7 SASI_Mm01_00141440 predicted 1650
8 SASI_Mm02_00328911 predicted 1030
9 SASI_Mm01_00141441 predicted 852
10 SASI_Mm01_00141442 predicted 793
11 SASI_Mm01_00141443 predicted 2154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152787
VALIDATED
TAB3 MISSION shRNA Bacterial Glycerol Stock
TGF-beta activated kinase 1/MAP3K7 binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-2170s1c1
Sequence:CCGGGCGGTTGAAGTCTGAAGTTAACTCGAGTTAACTTCAGACTTCAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152787.2-816s1c1
Sequence:CCGGCCCAACTTAATGGTGGTCGAACTCGAGTTCGACCACCATTAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-2257s1c1
Sequence:CCGGGCCTGAGGAAATGACAAGATTCTCGAGAATCTTGTCATTTCCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-1088s1c1
Sequence:CCGGCCTCCTTCATACATGCACATACTCGAGTATGTGCATGTATGAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152787.2-3550s1c1
Sequence:CCGGCCAGTAGCACAGTGAATGTATCTCGAGATACATTCACTGTGCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152787.3-1441s21c1
Sequence:CCGGCACTATAGCCAGCGTCCTTTACTCGAGTAAAGGACGCTGGCTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_152787.3-2860s21c1
Sequence:CCGGGGAAACCTCGGGACTCTATTCCTCGAGGAATAGAGTCCCGAGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152787.3-1717s21c1
Sequence:CCGGCCATACACAGCATCTAGTTTACTCGAGTAAACTAGATGCTGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152787.3-3115s21c1
Sequence:CCGGACTGCTGAGTGGCCCTTATTTCTCGAGAAATAAGGGCCACTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152787.3-945s21c1
Sequence:CCGGTGGTCGAACACTGGTACATAGCTCGAGCTATGTACCAGTGTTCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152787
VALIDATED
TAB3 MISSION shRNA shRNA Plasmid DNA
TGF-beta activated kinase 1/MAP3K7 binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-2170s1c1
Sequence:CCGGGCGGTTGAAGTCTGAAGTTAACTCGAGTTAACTTCAGACTTCAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152787.2-816s1c1
Sequence:CCGGCCCAACTTAATGGTGGTCGAACTCGAGTTCGACCACCATTAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-2257s1c1
Sequence:CCGGGCCTGAGGAAATGACAAGATTCTCGAGAATCTTGTCATTTCCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-1088s1c1
Sequence:CCGGCCTCCTTCATACATGCACATACTCGAGTATGTGCATGTATGAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152787.2-3550s1c1
Sequence:CCGGCCAGTAGCACAGTGAATGTATCTCGAGATACATTCACTGTGCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152787.3-1441s21c1
Sequence:CCGGCACTATAGCCAGCGTCCTTTACTCGAGTAAAGGACGCTGGCTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_152787.3-2860s21c1
Sequence:CCGGGGAAACCTCGGGACTCTATTCCTCGAGGAATAGAGTCCCGAGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152787.3-1717s21c1
Sequence:CCGGCCATACACAGCATCTAGTTTACTCGAGTAAACTAGATGCTGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152787.3-3115s21c1
Sequence:CCGGACTGCTGAGTGGCCCTTATTTCTCGAGAAATAAGGGCCACTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152787.3-945s21c1
Sequence:CCGGTGGTCGAACACTGGTACATAGCTCGAGCTATGTACCAGTGTTCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152787
VALIDATED
TAB3 MISSION shRNA Lentiviral Transduction Particles
TGF-beta activated kinase 1/MAP3K7 binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-2170s1c1
Sequence:CCGGGCGGTTGAAGTCTGAAGTTAACTCGAGTTAACTTCAGACTTCAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152787.2-816s1c1
Sequence:CCGGCCCAACTTAATGGTGGTCGAACTCGAGTTCGACCACCATTAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-2257s1c1
Sequence:CCGGGCCTGAGGAAATGACAAGATTCTCGAGAATCTTGTCATTTCCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152787.2-1088s1c1
Sequence:CCGGCCTCCTTCATACATGCACATACTCGAGTATGTGCATGTATGAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152787.2-3550s1c1
Sequence:CCGGCCAGTAGCACAGTGAATGTATCTCGAGATACATTCACTGTGCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152787.3-1441s21c1
Sequence:CCGGCACTATAGCCAGCGTCCTTTACTCGAGTAAAGGACGCTGGCTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_152787.3-2860s21c1
Sequence:CCGGGGAAACCTCGGGACTCTATTCCTCGAGGAATAGAGTCCCGAGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152787.3-1717s21c1
Sequence:CCGGCCATACACAGCATCTAGTTTACTCGAGTAAACTAGATGCTGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152787.3-3115s21c1
Sequence:CCGGACTGCTGAGTGGCCCTTATTTCTCGAGAAATAAGGGCCACTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152787.3-945s21c1
Sequence:CCGGTGGTCGAACACTGGTACATAGCTCGAGCTATGTACCAGTGTTCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025729
TAB3 MISSION shRNA Bacterial Glycerol Stock
TGF-beta activated kinase 1/MAP3K7 binding protein 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.2-1907s1c1
Sequence:CCGGGCTTGCTATGGAAGTTAGGTACTCGAGTACCTAACTTCCATAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.2-1895s1c1
Sequence:CCGGCCCAGTTCATTTGCTTGCTATCTCGAGATAGCAAGCAAATGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-849s21c1
Sequence:CCGGACATGCACATACCTCGGTATACTCGAGTATACCGAGGTATGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.3-1310s1c1
Sequence:CCGGCAACAAGGACCTCCTAGTTATCTCGAGATAACTAGGAGGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1457s21c1
Sequence:CCGGAGTCCGTCACCTATCAGTAATCTCGAGATTACTGATAGGTGACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-969s21c1
Sequence:CCGGATGGATCTCCTGGGTCTATTTCTCGAGAAATAGACCCAGGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1310s21c1
Sequence:CCGGCAACAAGGACCTCCTAGTTATCTCGAGATAACTAGGAGGTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-692s21c1
Sequence:CCGGGCTGCTACTCCCAACTATAATCTCGAGATTATAGTTGGGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025729.3-3418s21c1
Sequence:CCGGTTGTGCCGTAGTCCTAATTTACTCGAGTAAATTAGGACTACGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1076s21c1
Sequence:CCGGCATTACAGCCAGCGTCCTTTACTCGAGTAAAGGACGCTGGCTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-580s21c1
Sequence:CCGGTGGTCGGACACTGGTACATAGCTCGAGCTATGTACCAGTGTCCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025729
TAB3 MISSION shRNA shRNA Plasmid DNA
TGF-beta activated kinase 1/MAP3K7 binding protein 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.2-1907s1c1
Sequence:CCGGGCTTGCTATGGAAGTTAGGTACTCGAGTACCTAACTTCCATAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.2-1895s1c1
Sequence:CCGGCCCAGTTCATTTGCTTGCTATCTCGAGATAGCAAGCAAATGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-849s21c1
Sequence:CCGGACATGCACATACCTCGGTATACTCGAGTATACCGAGGTATGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.3-1310s1c1
Sequence:CCGGCAACAAGGACCTCCTAGTTATCTCGAGATAACTAGGAGGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1457s21c1
Sequence:CCGGAGTCCGTCACCTATCAGTAATCTCGAGATTACTGATAGGTGACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-969s21c1
Sequence:CCGGATGGATCTCCTGGGTCTATTTCTCGAGAAATAGACCCAGGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1310s21c1
Sequence:CCGGCAACAAGGACCTCCTAGTTATCTCGAGATAACTAGGAGGTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-692s21c1
Sequence:CCGGGCTGCTACTCCCAACTATAATCTCGAGATTATAGTTGGGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025729.3-3418s21c1
Sequence:CCGGTTGTGCCGTAGTCCTAATTTACTCGAGTAAATTAGGACTACGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1076s21c1
Sequence:CCGGCATTACAGCCAGCGTCCTTTACTCGAGTAAAGGACGCTGGCTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-580s21c1
Sequence:CCGGTGGTCGGACACTGGTACATAGCTCGAGCTATGTACCAGTGTCCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025729
TAB3 MISSION shRNA Lentiviral Transduction Particles
TGF-beta activated kinase 1/MAP3K7 binding protein 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.2-1907s1c1
Sequence:CCGGGCTTGCTATGGAAGTTAGGTACTCGAGTACCTAACTTCCATAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.2-1895s1c1
Sequence:CCGGCCCAGTTCATTTGCTTGCTATCTCGAGATAGCAAGCAAATGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-849s21c1
Sequence:CCGGACATGCACATACCTCGGTATACTCGAGTATACCGAGGTATGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025729.3-1310s1c1
Sequence:CCGGCAACAAGGACCTCCTAGTTATCTCGAGATAACTAGGAGGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1457s21c1
Sequence:CCGGAGTCCGTCACCTATCAGTAATCTCGAGATTACTGATAGGTGACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-969s21c1
Sequence:CCGGATGGATCTCCTGGGTCTATTTCTCGAGAAATAGACCCAGGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1310s21c1
Sequence:CCGGCAACAAGGACCTCCTAGTTATCTCGAGATAACTAGGAGGTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-692s21c1
Sequence:CCGGGCTGCTACTCCCAACTATAATCTCGAGATTATAGTTGGGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025729.3-3418s21c1
Sequence:CCGGTTGTGCCGTAGTCCTAATTTACTCGAGTAAATTAGGACTACGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-1076s21c1
Sequence:CCGGCATTACAGCCAGCGTCCTTTACTCGAGTAAAGGACGCTGGCTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025729.3-580s21c1
Sequence:CCGGTGGTCGGACACTGGTACATAGCTCGAGCTATGTACCAGTGTCCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks