EMAIL THIS PAGE TO A FRIEND

TAC1

tachykinin, precursor 1

Synonyms: Hs.2563 NK2 NKNA NPK TAC2
Gene ID:
Human(6863) Summary: This gene encodes four products of the tachykinin peptide hormone family, substance P and neurokinin A, as well as the related peptides, neuropeptide K and neuropeptide gamma. These hormones are thought to function as neurotransmitters which interact with nerve receptors and smooth muscle cells. They are known to induce behavioral responses and function as vasodilators and secretagogues. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(21333) tachykinin 1
Rat(24806) tachykinin, precursor 1
Thale Cress(820085) telomerase activator1
chicken(420573) tachykinin, precursor 1
domestic cat(101095481) tachykinin, precursor 1
dog(475239) tachykinin, precursor 1
Zebrafish(555634) tachykinin 1
cow(281512) tachykinin, precursor 1
sheep(100034669) tachykinin, precursor 1
domestic guinea pig(100713032) tachykinin, precursor 1
naked mole-rat(101703449) tachykinin, precursor 1
Domestic Rabbit(100009275) tachykinin, precursor 1
182 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S3144 [D-Arg1, D-Phe5, D-Trp7,9, Leu11]-Substance P ≥95% (HPLC) human, mouse, rat pricing
S3641 [D-Arg1, D-Trp7,9, Leu11]-Substance P ≥97% (HPLC) human, mouse, rat pricing
G114 GR 73632 >97% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003182 Rosetta Predictions human pricing
NM_013996 Rosetta Predictions human pricing
NM_013997 Rosetta Predictions human pricing
NM_013998 Rosetta Predictions human pricing
NM_001124768 Rosetta Predictions rat pricing
NM_001124769 Rosetta Predictions rat pricing
NM_001124770 Rosetta Predictions rat pricing
NM_012666 Rosetta Predictions rat pricing
NM_009311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095814 predicted 487
2 SASI_Hs01_00095815 predicted 541
3 SASI_Hs01_00095816 predicted 597
4 SASI_Hs01_00095817 predicted 775
5 SASI_Hs01_00095819 predicted 593
6 SASI_Hs01_00095820 predicted 697
7 SASI_Hs01_00095821 predicted 840
8 SASI_Hs01_00095822 predicted 679
9 SASI_Hs01_00095823 predicted 321
10 SASI_Hs02_00335209 predicted 581
11 SASI_Hs01_00095818 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038463 predicted 491
2 SASI_Hs02_00344959 predicted 813
3 SASI_Hs01_00038464 predicted 542
4 SASI_Hs01_00038465 predicted 721
5 SASI_Hs01_00038467 predicted 651
6 SASI_Hs01_00038468 predicted 534
7 SASI_Hs02_00344960 predicted 777
8 SASI_Hs01_00038469 predicted 620
9 SASI_Hs01_00038470 predicted 325
10 SASI_Hs01_00038472 predicted 453
11 SASI_Hs01_00038466 predicted 635
12 SASI_Hs01_00038471 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175784 predicted 1029
2 SASI_Hs01_00175785 predicted 918
3 SASI_Hs01_00175786 predicted 820
4 SASI_Hs01_00175787 predicted 550
5 SASI_Hs02_00344961 predicted 584
6 SASI_Hs01_00175789 predicted 594
7 SASI_Hs01_00175790 predicted 548
8 SASI_Hs01_00175791 predicted 1055
9 SASI_Hs01_00175792 predicted 787
10 SASI_Hs01_00175793 predicted 323
11 SASI_Hs01_00175788 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133670 predicted 971
2 SASI_Hs01_00133671 predicted 861
3 SASI_Hs01_00133673 predicted 763
4 SASI_Hs01_00133674 predicted 504
5 SASI_Hs01_00133675 predicted 529
6 SASI_Hs01_00133677 predicted 536
7 SASI_Hs01_00133678 predicted 1007
8 SASI_Hs01_00133679 predicted 490
9 SASI_Hs02_00344962 predicted 732
10 SASI_Hs02_00344963 predicted 318
11 SASI_Hs01_00133672 predicted 583
12 SASI_Hs01_00133676 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001124768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252763 predicted 591
2 SASI_Rn02_00252764 predicted 618
3 SASI_Rn02_00252765 predicted 589
4 SASI_Rn02_00252766 predicted 695
5 SASI_Rn02_00252767 predicted 668
6 SASI_Rn02_00252768 predicted 597
7 SASI_Rn02_00252769 predicted 693
8 SASI_Rn02_00252770 predicted 719
9 SASI_Rn02_00252771 predicted 670
10 SASI_Rn02_00252772 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001124769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252773 predicted 562
2 SASI_Rn02_00252774 predicted 538
3 SASI_Rn02_00252775 predicted 643
4 SASI_Rn02_00252776 predicted 619
5 SASI_Rn02_00252777 predicted 550
6 SASI_Rn02_00252778 predicted 575
7 SASI_Rn02_00252779 predicted 646
8 SASI_Rn02_00252780 predicted 666
9 SASI_Rn02_00252781 predicted 615
10 SASI_Rn02_00252782 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001124770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252783 predicted 609
2 SASI_Rn02_00252784 predicted 586
3 SASI_Rn02_00252785 predicted 686
4 SASI_Rn02_00252786 predicted 659
5 SASI_Rn02_00252787 predicted 593
6 SASI_Rn02_00252788 predicted 624
7 SASI_Rn02_00252789 predicted 690
8 SASI_Rn02_00252790 predicted 710
9 SASI_Rn02_00252791 predicted 656
10 SASI_Rn02_00252792 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259924 predicted 631
2 SASI_Rn02_00259925 predicted 664
3 SASI_Rn01_00044910 predicted 636
4 SASI_Rn02_00259926 predicted 741
5 SASI_Rn02_00259927 predicted 720
6 SASI_Rn02_00259928 predicted 650
7 SASI_Rn02_00259929 predicted 738
8 SASI_Rn02_00259930 predicted 766
9 SASI_Rn02_00259931 predicted 718
10 SASI_Rn02_00259932 predicted 713
11 SASI_Rn01_00044908 predicted 499
12 SASI_Rn01_00044909 predicted 558
13 SASI_Rn01_00044911 predicted 394
14 SASI_Rn01_00044912 predicted 448
15 SASI_Rn01_00044913 predicted 478
16 SASI_Rn01_00044914 predicted 340
17 SASI_Rn01_00044915 predicted 639
18 SASI_Rn01_00044916 predicted 353
19 SASI_Rn01_00044917 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315843 predicted 586
2 SASI_Mm01_00179188 predicted 805
3 SASI_Mm01_00179186 predicted 396
4 SASI_Mm02_00315844 predicted 585
5 SASI_Mm02_00315845 predicted 697
6 SASI_Mm01_00179187 predicted 636
7 SASI_Mm02_00315846 predicted 683
8 SASI_Mm01_00179189 predicted 360
9 SASI_Mm01_00179190 predicted 281
10 SASI_Mm01_00179191 predicted 216
11 SASI_Mm01_00179185 predicted 571
12 SASI_Mm01_00179192 predicted 699
13 SASI_Mm01_00179193 predicted 651
14 SASI_Mm01_00179194 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003182
TAC1 MISSION shRNA Bacterial Glycerol Stock
tachykinin, precursor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003182.2-602s21c1
Sequence:CCGGGGAGTGCAATGCAGAATTATGCTCGAGCATAATTCTGCATTGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003182.2-489s21c1
Sequence:CCGGGGCCCTGTTAAAGGCTCTTTACTCGAGTAAAGAGCCTTTAACAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003182.2-677s21c1
Sequence:CCGGATGGGCAATGACAGGTAAATTCTCGAGAATTTACCTGTCATTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003182.1-599s1c1
Sequence:CCGGGACATGCACTATGAGGAATAACTCGAGTTATTCCTCATAGTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-334s1c1
Sequence:CCGGGTTCTTTGGATTAATGGGCAACTCGAGTTGCCCATTAATCCAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-444s1c1
Sequence:CCGGCAGATTCCTTTGTTGGACTAACTCGAGTTAGTCCAACAAAGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003182.1-715s1c1
Sequence:CCGGCCAATATGATGACTCCCTTAACTCGAGTTAAGGGAGTCATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-359s1c1
Sequence:CCGGGATGCTGATTCCTCAATTGAACTCGAGTTCAATTGAGGAATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003182
TAC1 MISSION shRNA shRNA Plasmid DNA
tachykinin, precursor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003182.2-602s21c1
Sequence:CCGGGGAGTGCAATGCAGAATTATGCTCGAGCATAATTCTGCATTGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003182.2-489s21c1
Sequence:CCGGGGCCCTGTTAAAGGCTCTTTACTCGAGTAAAGAGCCTTTAACAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003182.2-677s21c1
Sequence:CCGGATGGGCAATGACAGGTAAATTCTCGAGAATTTACCTGTCATTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003182.1-599s1c1
Sequence:CCGGGACATGCACTATGAGGAATAACTCGAGTTATTCCTCATAGTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-334s1c1
Sequence:CCGGGTTCTTTGGATTAATGGGCAACTCGAGTTGCCCATTAATCCAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-444s1c1
Sequence:CCGGCAGATTCCTTTGTTGGACTAACTCGAGTTAGTCCAACAAAGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003182.1-715s1c1
Sequence:CCGGCCAATATGATGACTCCCTTAACTCGAGTTAAGGGAGTCATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-359s1c1
Sequence:CCGGGATGCTGATTCCTCAATTGAACTCGAGTTCAATTGAGGAATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003182
TAC1 MISSION shRNA Lentiviral Transduction Particles
tachykinin, precursor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003182.2-602s21c1
Sequence:CCGGGGAGTGCAATGCAGAATTATGCTCGAGCATAATTCTGCATTGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003182.2-489s21c1
Sequence:CCGGGGCCCTGTTAAAGGCTCTTTACTCGAGTAAAGAGCCTTTAACAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003182.2-677s21c1
Sequence:CCGGATGGGCAATGACAGGTAAATTCTCGAGAATTTACCTGTCATTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003182.1-599s1c1
Sequence:CCGGGACATGCACTATGAGGAATAACTCGAGTTATTCCTCATAGTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-334s1c1
Sequence:CCGGGTTCTTTGGATTAATGGGCAACTCGAGTTGCCCATTAATCCAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-444s1c1
Sequence:CCGGCAGATTCCTTTGTTGGACTAACTCGAGTTAGTCCAACAAAGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003182.1-715s1c1
Sequence:CCGGCCAATATGATGACTCCCTTAACTCGAGTTAAGGGAGTCATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003182.1-359s1c1
Sequence:CCGGGATGCTGATTCCTCAATTGAACTCGAGTTCAATTGAGGAATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009311
TAC1 MISSION shRNA Bacterial Glycerol Stock
tachykinin, precursor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009311.1-504s1c1
Sequence:CCGGGCACTATCTATTCATCTTCATCTCGAGATGAAGATGAATAGATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-469s1c1
Sequence:CCGGGAACTACGAAAGAAGACGTAACTCGAGTTACGTCTTCTTTCGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-281s1c1
Sequence:CCGGCCTCAGCAGTTCTTTGGATTACTCGAGTAATCCAAAGAACTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-170s1c1
Sequence:CCGGGCCAACGATGATCTAAATTATCTCGAGATAATTTAGATCATCGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-445s1c1
Sequence:CCGGCGCTTATGAAAGAAGCGCAATCTCGAGATTGCGCTTCTTTCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009311
TAC1 MISSION shRNA shRNA Plasmid DNA
tachykinin, precursor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009311.1-504s1c1
Sequence:CCGGGCACTATCTATTCATCTTCATCTCGAGATGAAGATGAATAGATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-469s1c1
Sequence:CCGGGAACTACGAAAGAAGACGTAACTCGAGTTACGTCTTCTTTCGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-281s1c1
Sequence:CCGGCCTCAGCAGTTCTTTGGATTACTCGAGTAATCCAAAGAACTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-170s1c1
Sequence:CCGGGCCAACGATGATCTAAATTATCTCGAGATAATTTAGATCATCGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-445s1c1
Sequence:CCGGCGCTTATGAAAGAAGCGCAATCTCGAGATTGCGCTTCTTTCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009311
TAC1 MISSION shRNA Lentiviral Transduction Particles
tachykinin, precursor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009311.1-504s1c1
Sequence:CCGGGCACTATCTATTCATCTTCATCTCGAGATGAAGATGAATAGATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-469s1c1
Sequence:CCGGGAACTACGAAAGAAGACGTAACTCGAGTTACGTCTTCTTTCGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-281s1c1
Sequence:CCGGCCTCAGCAGTTCTTTGGATTACTCGAGTAATCCAAAGAACTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-170s1c1
Sequence:CCGGGCCAACGATGATCTAAATTATCTCGAGATAATTTAGATCATCGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009311.1-445s1c1
Sequence:CCGGCGCTTATGAAAGAAGCGCAATCTCGAGATTGCGCTTCTTTCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks