EMAIL THIS PAGE TO A FRIEND

TAC3

tachykinin 3

Synonyms: HH10 NKB NKNB PRO1155 ZNEUROK1
UniProtKB ID: Q9UHF0, Q6IAG2, Q71BC6, Q71BC9
Gene ID:
Human(6866) Summary: This gene encodes a member of the tachykinin family of secreted neuropeptides. The encoded protein is primarily expressed in the central and peripheral nervous system and functions as a neurotransmitter. This protein is the ligand for the neurokinin-3 receptor. This protein is also expressed in the outer syncytiotrophoblast of the placenta and may be associated with pregnancy-induced hypertension and pre-eclampsia. Mutations in this gene are associated with normosmic hypogonadotropic hypogonadism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Rat(29191) tachykinin 3
cow(281513) tachykinin 3
sheep(443213) tachykinin 3
dog(607315) tachykinin 3
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013251 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125591 MISSION® esiRNA esiRNA human TAC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006667 Rosetta Predictions human pricing
NM_013251 Rosetta Predictions human pricing
NM_019162 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140337 predicted 316
2 SASI_Hs01_00140338 predicted 551
3 SASI_Hs01_00140339 predicted 387
4 SASI_Hs01_00140340 predicted 603
5 SASI_Hs01_00140341 predicted 348
6 SASI_Hs02_00305131 predicted 259
7 SASI_Hs02_00305132 predicted 462
8 SASI_Hs01_00140342 predicted 452
9 SASI_Hs01_00140343 predicted 415
10 SASI_Hs01_00140344 predicted 375
11 SASI_Hs01_00140345 predicted 332
12 SASI_Hs01_00140346 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219622 predicted 311
2 SASI_Hs01_00219623 predicted 382
3 SASI_Hs01_00219624 predicted 385
4 SASI_Hs01_00219625 predicted 459
5 SASI_Hs01_00219627 predicted 479
6 SASI_Hs01_00219628 predicted 346
7 SASI_Hs02_00344464 predicted 263
8 SASI_Hs01_00219629 predicted 445
9 SASI_Hs01_00219630 predicted 320
10 SASI_Hs01_00219631 predicted 420
11 SASI_Hs01_00219626 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101775 predicted 374
2 SASI_Rn01_00101776 predicted 359
3 SASI_Rn01_00101777 predicted 488
4 SASI_Rn01_00101778 predicted 272
5 SASI_Rn01_00101779 predicted 355
6 SASI_Rn01_00101780 predicted 333
7 SASI_Rn01_00101781 predicted 221
8 SASI_Rn01_00101782 predicted 359
9 SASI_Rn01_00101783 predicted 442
10 SASI_Rn01_00101784 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013251
TAC3 MISSION shRNA Bacterial Glycerol Stock
tachykinin 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.1-233s1c1
Sequence:CCGGCAAGAGGGATCCAGATCTCTACTCGAGTAGAGATCTGGATCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.1-360s1c1
Sequence:CCGGCGTGACATGCATGACTTCTTTCTCGAGAAAGAAGTCATGCATGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-369s1c1
Sequence:CCGGCATGACTTCTTTGTGGGACTTCTCGAGAAGTCCCACAAAGAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-356s1c1
Sequence:CCGGGAAACGTGACATGCATGACTTCTCGAGAAGTCATGCATGTCACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-328s1c1
Sequence:CCGGCAGATCCTAAGGAATCAACATCTCGAGATGTTGATTCCTTAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-426s1c1
Sequence:CCGGGATGTGAATCAAGAGAACGTCCTCGAGGACGTTCTCTTGATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-327s21c1
Sequence:CCGGCTCTGGAGGGATTGCTCAAAGCTCGAGCTTTGAGCAATCCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-453s21c1
Sequence:CCGGACTCTCCTACGGATGTGAATCCTCGAGGATTCACATCCGTAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-385s21c1
Sequence:CCGGATCTCCCGAGAAACGTGACATCTCGAGATGTCACGTTTCTCGGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.2-327s1c1
Sequence:CCGGCTCTGGAGGGATTGCTCAAAGCTCGAGCTTTGAGCAATCCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013251.2-617s1c1
Sequence:CCGGTTCCCTGTTCTTGTAACATTCCTCGAGGAATGTTACAAGAACAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-409s21c1
Sequence:GTACCGGTGACTTCTTTGTGGGACTTATCTCGAGATAAGTCCCACAAAGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013251.2-552s1c1
Sequence:CCGGTGCATTAGGAAGACCTCTTTCCTCGAGGAAAGAGGTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013251.2-552s21c1
Sequence:CCGGTGCATTAGGAAGACCTCTTTCCTCGAGGAAAGAGGTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013251
TAC3 MISSION shRNA shRNA Plasmid DNA
tachykinin 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.1-233s1c1
Sequence:CCGGCAAGAGGGATCCAGATCTCTACTCGAGTAGAGATCTGGATCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.1-360s1c1
Sequence:CCGGCGTGACATGCATGACTTCTTTCTCGAGAAAGAAGTCATGCATGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-369s1c1
Sequence:CCGGCATGACTTCTTTGTGGGACTTCTCGAGAAGTCCCACAAAGAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-356s1c1
Sequence:CCGGGAAACGTGACATGCATGACTTCTCGAGAAGTCATGCATGTCACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-328s1c1
Sequence:CCGGCAGATCCTAAGGAATCAACATCTCGAGATGTTGATTCCTTAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-426s1c1
Sequence:CCGGGATGTGAATCAAGAGAACGTCCTCGAGGACGTTCTCTTGATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-327s21c1
Sequence:CCGGCTCTGGAGGGATTGCTCAAAGCTCGAGCTTTGAGCAATCCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-453s21c1
Sequence:CCGGACTCTCCTACGGATGTGAATCCTCGAGGATTCACATCCGTAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-385s21c1
Sequence:CCGGATCTCCCGAGAAACGTGACATCTCGAGATGTCACGTTTCTCGGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.2-327s1c1
Sequence:CCGGCTCTGGAGGGATTGCTCAAAGCTCGAGCTTTGAGCAATCCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013251.2-617s1c1
Sequence:CCGGTTCCCTGTTCTTGTAACATTCCTCGAGGAATGTTACAAGAACAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-409s21c1
Sequence:GTACCGGTGACTTCTTTGTGGGACTTATCTCGAGATAAGTCCCACAAAGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013251.2-552s1c1
Sequence:CCGGTGCATTAGGAAGACCTCTTTCCTCGAGGAAAGAGGTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013251.2-552s21c1
Sequence:CCGGTGCATTAGGAAGACCTCTTTCCTCGAGGAAAGAGGTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013251
TAC3 MISSION shRNA Lentiviral Transduction Particles
tachykinin 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.1-233s1c1
Sequence:CCGGCAAGAGGGATCCAGATCTCTACTCGAGTAGAGATCTGGATCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.1-360s1c1
Sequence:CCGGCGTGACATGCATGACTTCTTTCTCGAGAAAGAAGTCATGCATGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-369s1c1
Sequence:CCGGCATGACTTCTTTGTGGGACTTCTCGAGAAGTCCCACAAAGAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-356s1c1
Sequence:CCGGGAAACGTGACATGCATGACTTCTCGAGAAGTCATGCATGTCACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-328s1c1
Sequence:CCGGCAGATCCTAAGGAATCAACATCTCGAGATGTTGATTCCTTAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013251.1-426s1c1
Sequence:CCGGGATGTGAATCAAGAGAACGTCCTCGAGGACGTTCTCTTGATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-327s21c1
Sequence:CCGGCTCTGGAGGGATTGCTCAAAGCTCGAGCTTTGAGCAATCCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-453s21c1
Sequence:CCGGACTCTCCTACGGATGTGAATCCTCGAGGATTCACATCCGTAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-385s21c1
Sequence:CCGGATCTCCCGAGAAACGTGACATCTCGAGATGTCACGTTTCTCGGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013251.2-327s1c1
Sequence:CCGGCTCTGGAGGGATTGCTCAAAGCTCGAGCTTTGAGCAATCCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013251.2-617s1c1
Sequence:CCGGTTCCCTGTTCTTGTAACATTCCTCGAGGAATGTTACAAGAACAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013251.2-409s21c1
Sequence:GTACCGGTGACTTCTTTGTGGGACTTATCTCGAGATAAGTCCCACAAAGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013251.2-552s1c1
Sequence:CCGGTGCATTAGGAAGACCTCTTTCCTCGAGGAAAGAGGTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013251.2-552s21c1
Sequence:CCGGTGCATTAGGAAGACCTCTTTCCTCGAGGAAAGAGGTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks