EMAIL THIS PAGE TO A FRIEND

TAC4

tachykinin 4 (hemokinin)

Synonyms: EK HK-1 HK1 PPT-C
Gene ID:
Human(255061) Summary: This gene is a member of the tachykinin family of neurotransmitter-encoding genes. Tachykinin proteins are cleaved into small, secreted peptides that activate members of a family of receptor proteins. The products of this gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The products of this gene lack a dibasic cleavage site found in other tachykinin proteins. Consequently, the nature of the cleavage products generated in vivo remains to be determined. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(93670) tachykinin 4
Rat(282829) tachykinin 4 (hemokinin)
Zebrafish(100151267) tachykinin 4 (hemokinin)
dog(100688531) tachykinin 4 (hemokinin)
domestic guinea pig(101787034) tachykinin 4 (hemokinin)
naked mole-rat(101698306) tachykinin 4 (hemokinin)
Domestic Rabbit(100008925) tachykinin 4 (hemokinin)
cow(101902680) tachykinin 4 (hemokinin)
sheep(101118544) tachykinin 4 (hemokinin)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302037 ANTI-TAC4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077503 Rosetta Predictions human pricing
NM_001077504 Rosetta Predictions human pricing
NM_001077505 Rosetta Predictions human pricing
NM_001077506 Rosetta Predictions human pricing
NM_170685 Rosetta Predictions human pricing
NM_172328 Rosetta Predictions rat pricing
NM_053093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312874 predicted 326
2 SASI_Hs02_00312875 predicted 260
3 SASI_Hs02_00312876 predicted 321
4 SASI_Hs02_00312877 predicted 258
5 SASI_Hs02_00312878 predicted 359
6 SASI_Hs02_00312879 predicted 368
7 SASI_Hs02_00312880 predicted 269
8 SASI_Hs02_00312881 predicted 268
9 SASI_Hs02_00312882 predicted 356
10 SASI_Hs02_00312883 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312884 predicted 230
2 SASI_Hs02_00312885 predicted 229
3 SASI_Hs02_00312886 predicted 331
4 SASI_Hs02_00312887 predicted 237
5 SASI_Hs02_00312888 predicted 341
6 SASI_Hs02_00312889 predicted 226
7 SASI_Hs02_00312890 predicted 240
8 SASI_Hs02_00312891 predicted 241
9 SASI_Hs02_00312892 predicted 328
10 SASI_Hs02_00312893 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312894 predicted 195
2 SASI_Hs02_00312895 predicted 199
3 SASI_Hs02_00312896 predicted 197
4 SASI_Hs02_00312897 predicted 300
5 SASI_Hs02_00312898 predicted 202
6 SASI_Hs02_00312899 predicted 305
7 SASI_Hs02_00312900 predicted 206
8 SASI_Hs02_00312901 predicted 206
9 SASI_Hs02_00312902 predicted 297
10 SASI_Hs02_00312903 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312904 predicted 352
2 SASI_Hs02_00312905 predicted 349
3 SASI_Hs02_00312906 predicted 397
4 SASI_Hs02_00312907 predicted 402
5 SASI_Hs02_00312908 predicted 390
6 SASI_Hs02_00312909 predicted 358
7 SASI_Hs02_00312910 predicted 345
8 SASI_Hs02_00312911 predicted 350
9 SASI_Hs02_00312912 predicted 392
10 SASI_Hs02_00312913 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367606 predicted 368
2 SASI_Hs02_00367607 predicted 371
3 SASI_Hs02_00367608 predicted 410
4 SASI_Hs02_00367609 predicted 415
5 SASI_Hs02_00367610 predicted 406
6 SASI_Hs02_00367611 predicted 375
7 SASI_Hs02_00367612 predicted 360
8 SASI_Hs02_00367613 predicted 363
9 SASI_Hs02_00367614 predicted 406
10 SASI_Hs02_00367615 predicted 413
11 SASI_Hs01_00166687 predicted 106
12 SASI_Hs01_00166688 predicted 178
13 SASI_Hs01_00166689 predicted 107
14 SASI_Hs01_00166690 predicted 97
15 SASI_Hs01_00166691 predicted 92
16 SASI_Hs01_00166692 predicted 188
17 SASI_Hs01_00166693 predicted 14
18 SASI_Hs01_00166694 predicted 87
19 SASI_Hs01_00166695 predicted 85
20 SASI_Hs01_00166696 predicted 175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071668 predicted 739
2 SASI_Rn01_00071669 predicted 464
3 SASI_Rn01_00071670 predicted 410
4 SASI_Rn01_00071671 predicted 677
5 SASI_Rn01_00071673 predicted 368
6 SASI_Rn01_00071674 predicted 830
7 SASI_Rn01_00071675 predicted 615
8 SASI_Rn01_00071676 predicted 609
9 SASI_Rn02_00269218 predicted 308
10 SASI_Rn01_00071677 predicted 483
11 SASI_Rn01_00071672 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042295 predicted 818
2 SASI_Mm01_00042296 predicted 385
3 SASI_Mm01_00042297 predicted 652
4 SASI_Mm01_00042298 predicted 991
5 SASI_Mm01_00042299 predicted 410
6 SASI_Mm01_00042300 predicted 822
7 SASI_Mm01_00042301 predicted 784
8 SASI_Mm01_00042302 predicted 886
9 SASI_Mm01_00042303 predicted 805
10 SASI_Mm01_00042304 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077503
TAC4 MISSION shRNA Bacterial Glycerol Stock
tachykinin 4 (hemokinin)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-272s21c1
Sequence:CCGGAGGCCCAAGGTTCAGAGTAAACTCGAGTTTACTCTGAACCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-198s21c1
Sequence:CCGGAGCATATCAGCTGGAACACACCTCGAGGTGTGTTCCAGCTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077503.1-399s21c1
Sequence:CCGGCATCGCTGGCACTTCACACAACTCGAGTTGTGTGAAGTGCCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-233s21c1
Sequence:CCGGTGGGCAAGAGAAGCCTGTTCACTCGAGTGAACAGGCTTCTCTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-155s21c1
Sequence:CCGGGCAAGGCAAGCCAGTTCTTTGCTCGAGCAAAGAACTGGCTTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077503
TAC4 MISSION shRNA shRNA Plasmid DNA
tachykinin 4 (hemokinin)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-272s21c1
Sequence:CCGGAGGCCCAAGGTTCAGAGTAAACTCGAGTTTACTCTGAACCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-198s21c1
Sequence:CCGGAGCATATCAGCTGGAACACACCTCGAGGTGTGTTCCAGCTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077503.1-399s21c1
Sequence:CCGGCATCGCTGGCACTTCACACAACTCGAGTTGTGTGAAGTGCCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-233s21c1
Sequence:CCGGTGGGCAAGAGAAGCCTGTTCACTCGAGTGAACAGGCTTCTCTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-155s21c1
Sequence:CCGGGCAAGGCAAGCCAGTTCTTTGCTCGAGCAAAGAACTGGCTTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077503
TAC4 MISSION shRNA Lentiviral Transduction Particles
tachykinin 4 (hemokinin)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-272s21c1
Sequence:CCGGAGGCCCAAGGTTCAGAGTAAACTCGAGTTTACTCTGAACCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-198s21c1
Sequence:CCGGAGCATATCAGCTGGAACACACCTCGAGGTGTGTTCCAGCTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077503.1-399s21c1
Sequence:CCGGCATCGCTGGCACTTCACACAACTCGAGTTGTGTGAAGTGCCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-233s21c1
Sequence:CCGGTGGGCAAGAGAAGCCTGTTCACTCGAGTGAACAGGCTTCTCTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077503.1-155s21c1
Sequence:CCGGGCAAGGCAAGCCAGTTCTTTGCTCGAGCAAAGAACTGGCTTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053093
TAC4 MISSION shRNA Bacterial Glycerol Stock
tachykinin 4 (hemokinin)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-1055s1c1
Sequence:CCGGGATTCCTGATGTTGCTACCAACTCGAGTTGGTAGCAACATCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-773s1c1
Sequence:CCGGGCAAAGCTTCACACTCTGTATCTCGAGATACAGAGTGTGAAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053093.1-304s1c1
Sequence:CCGGCCCAGCATTGAACTTAAGCTTCTCGAGAAGCTTAAGTTCAATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053093.1-387s1c1
Sequence:CCGGGTATCAGCTGGGACGTATAGTCTCGAGACTATACGTCCCAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-1038s1c1
Sequence:CCGGGAGCCTTCTTCCCTTTAGATTCTCGAGAATCTAAAGGGAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-823s1c1
Sequence:CCGGCAACGACGAGTTAGCAGTAATCTCGAGATTACTGCTAACTCGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053093
TAC4 MISSION shRNA shRNA Plasmid DNA
tachykinin 4 (hemokinin)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-1055s1c1
Sequence:CCGGGATTCCTGATGTTGCTACCAACTCGAGTTGGTAGCAACATCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-773s1c1
Sequence:CCGGGCAAAGCTTCACACTCTGTATCTCGAGATACAGAGTGTGAAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053093.1-304s1c1
Sequence:CCGGCCCAGCATTGAACTTAAGCTTCTCGAGAAGCTTAAGTTCAATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053093.1-387s1c1
Sequence:CCGGGTATCAGCTGGGACGTATAGTCTCGAGACTATACGTCCCAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-1038s1c1
Sequence:CCGGGAGCCTTCTTCCCTTTAGATTCTCGAGAATCTAAAGGGAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-823s1c1
Sequence:CCGGCAACGACGAGTTAGCAGTAATCTCGAGATTACTGCTAACTCGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053093
TAC4 MISSION shRNA Lentiviral Transduction Particles
tachykinin 4 (hemokinin)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-1055s1c1
Sequence:CCGGGATTCCTGATGTTGCTACCAACTCGAGTTGGTAGCAACATCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-773s1c1
Sequence:CCGGGCAAAGCTTCACACTCTGTATCTCGAGATACAGAGTGTGAAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053093.1-304s1c1
Sequence:CCGGCCCAGCATTGAACTTAAGCTTCTCGAGAAGCTTAAGTTCAATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053093.1-387s1c1
Sequence:CCGGGTATCAGCTGGGACGTATAGTCTCGAGACTATACGTCCCAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-1038s1c1
Sequence:CCGGGAGCCTTCTTCCCTTTAGATTCTCGAGAATCTAAAGGGAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053093.1-823s1c1
Sequence:CCGGCAACGACGAGTTAGCAGTAATCTCGAGATTACTGCTAACTCGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks