EMAIL THIS PAGE TO A FRIEND

TACC1

transforming, acidic coiled-coil containing protein 1

Synonyms: Ga55
Gene ID:
Human(6867) Summary: This locus may represent a breast cancer candidate gene. It is located close to FGFR1 on a region of chromosome 8 that is amplified in some breast cancers. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Mouse(320165) transforming, acidic coiled-coil containing protein 1
Rat(306562) transforming, acidic coiled-coil containing protein 1
Zebrafish(565711) transforming, acidic coiled-coil containing protein 1
Horse(100057571) transforming, acidic coiled-coil containing protein 1
domestic cat(101085625) transforming, acidic coiled-coil containing protein 1
dog(475581) transforming, acidic coiled-coil containing protein 1
chicken(431253) transforming, acidic coiled-coil containing protein 1
cow(507012) transforming, acidic coiled-coil containing protein 1
sheep(101114241) transforming, acidic coiled-coil containing protein 1
Domestic Rabbit(100351612) transforming, acidic coiled-coil containing protein 1
naked mole-rat(101698526) transforming, acidic coiled-coil containing protein 1
domestic guinea pig(100729970) transforming, acidic coiled-coil containing protein 1
189 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122824 Rosetta Predictions human pricing
NM_006283 Rosetta Predictions human pricing
NM_001004107 Rosetta Predictions rat pricing
NM_177089 Rosetta Predictions mouse pricing
NM_199323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327377 predicted 1297
2 SASI_Hs02_00327378 predicted 1291
3 SASI_Hs02_00327379 predicted 1184
4 SASI_Hs02_00327380 predicted 744
5 SASI_Hs02_00327381 predicted 994
6 SASI_Hs02_00327382 predicted 1252
7 SASI_Hs02_00327383 predicted 1370
8 SASI_Hs02_00327384 predicted 1206
9 SASI_Hs02_00327385 predicted 975
10 SASI_Hs02_00327386 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120896 predicted 2520
2 SASI_Hs02_00341262 predicted 2526
3 SASI_Hs02_00341263 predicted 2416
4 SASI_Hs01_00120904 predicted 1974
5 SASI_Hs01_00120905 predicted 2224
6 SASI_Hs02_00341264 predicted 2485
7 SASI_Hs02_00341265 predicted 2596
8 SASI_Hs02_00341266 predicted 2438
9 SASI_Hs02_00341267 predicted 2206
10 SASI_Hs02_00341268 predicted 2440
11 SASI_Hs01_00120897 predicted 1572
12 SASI_Hs01_00120898 predicted 1595
13 SASI_Hs01_00120899 predicted 1563
14 SASI_Hs01_00120900 predicted 1109
15 SASI_Hs01_00120901 predicted 1617
16 SASI_Hs01_00120902 predicted 1337
17 SASI_Hs01_00120903 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093970 predicted 1452
2 SASI_Rn01_00093971 predicted 1669
3 SASI_Rn01_00093972 predicted 366
4 SASI_Rn02_00198156 predicted 1938
5 SASI_Rn01_00093974 predicted 445
6 SASI_Rn01_00093975 predicted 583
7 SASI_Rn01_00093976 predicted 1613
8 SASI_Rn01_00093977 predicted 1362
9 SASI_Rn01_00093978 predicted 1959
10 SASI_Rn02_00198157 predicted 550
11 SASI_Rn01_00093969 predicted 1340
12 SASI_Rn01_00093973 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029190 predicted 1901
2 SASI_Mm01_00029191 predicted 2172
3 SASI_Mm01_00029192 predicted 1894
4 SASI_Mm01_00029193 predicted 2036
5 SASI_Mm01_00029194 predicted 1751
6 SASI_Mm01_00029195 predicted 1951
7 SASI_Mm01_00029196 predicted 2326
8 SASI_Mm01_00029197 predicted 1917
9 SASI_Mm01_00029198 predicted 1927
10 SASI_Mm01_00029199 predicted 1925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175475 predicted 549
2 SASI_Mm01_00175476 predicted 952
3 SASI_Mm01_00175477 predicted 680
4 SASI_Mm01_00175478 predicted 818
5 SASI_Mm01_00175479 predicted 1096
6 SASI_Mm01_00175480 predicted 1044
7 SASI_Mm01_00175481 predicted 1725
8 SASI_Mm01_00175482 predicted 696
9 SASI_Mm01_00175483 predicted 1081
10 SASI_Mm01_00175484 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006283
VALIDATED
TACC1 MISSION shRNA Bacterial Glycerol Stock
transforming, acidic coiled-coil containing protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1390s1c1
Sequence:CCGGGCATCAGTAAGTCAGCAGGTTCTCGAGAACCTGCTGACTTACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1852s1c1
Sequence:CCGGCCACGTCATGTGGTCAGAAATCTCGAGATTTCTGACCACATGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006283.1-2469s1c1
Sequence:CCGGCAGGATTACTTAGCCAGAGTTCTCGAGAACTCTGGCTAAGTAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006283.1-2294s1c1
Sequence:CCGGGACAAGTATGACCTCTCAGAACTCGAGTTCTGAGAGGTCATACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1391s1c1
Sequence:CCGGCATCAGTAAGTCAGCAGGTTTCTCGAGAAACCTGCTGACTTACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006283.1-5623s1c1
Sequence:CCGGGCCAAAGTGTAGATAGCCTTTCTCGAGAAAGGCTATCTACACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1747s21c1
Sequence:CCGGGAAGGCAAAGTCGCGTTTAATCTCGAGATTAAACGCGACTTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006283.2-5690s21c1
Sequence:CCGGGCCAAAGTGTAGATAGCCTTTCTCGAGAAAGGCTATCTACACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006283.2-1911s21c1
Sequence:CCGGCCACGTCATGTGGTCAGAAATCTCGAGATTTCTGACCACATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1000s21c1
Sequence:CCGGCTCCGCAGAAGCTGATCTAAACTCGAGTTTAGATCAGCTTCTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1450s21c1
Sequence:CCGGCATCAGTAAGTCAGCAGGTTTCTCGAGAAACCTGCTGACTTACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006283
VALIDATED
TACC1 MISSION shRNA shRNA Plasmid DNA
transforming, acidic coiled-coil containing protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1390s1c1
Sequence:CCGGGCATCAGTAAGTCAGCAGGTTCTCGAGAACCTGCTGACTTACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1852s1c1
Sequence:CCGGCCACGTCATGTGGTCAGAAATCTCGAGATTTCTGACCACATGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006283.1-2469s1c1
Sequence:CCGGCAGGATTACTTAGCCAGAGTTCTCGAGAACTCTGGCTAAGTAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006283.1-2294s1c1
Sequence:CCGGGACAAGTATGACCTCTCAGAACTCGAGTTCTGAGAGGTCATACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1391s1c1
Sequence:CCGGCATCAGTAAGTCAGCAGGTTTCTCGAGAAACCTGCTGACTTACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006283.1-5623s1c1
Sequence:CCGGGCCAAAGTGTAGATAGCCTTTCTCGAGAAAGGCTATCTACACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1747s21c1
Sequence:CCGGGAAGGCAAAGTCGCGTTTAATCTCGAGATTAAACGCGACTTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006283.2-5690s21c1
Sequence:CCGGGCCAAAGTGTAGATAGCCTTTCTCGAGAAAGGCTATCTACACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006283.2-1911s21c1
Sequence:CCGGCCACGTCATGTGGTCAGAAATCTCGAGATTTCTGACCACATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1000s21c1
Sequence:CCGGCTCCGCAGAAGCTGATCTAAACTCGAGTTTAGATCAGCTTCTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1450s21c1
Sequence:CCGGCATCAGTAAGTCAGCAGGTTTCTCGAGAAACCTGCTGACTTACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006283
VALIDATED
TACC1 MISSION shRNA Lentiviral Transduction Particles
transforming, acidic coiled-coil containing protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1390s1c1
Sequence:CCGGGCATCAGTAAGTCAGCAGGTTCTCGAGAACCTGCTGACTTACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1852s1c1
Sequence:CCGGCCACGTCATGTGGTCAGAAATCTCGAGATTTCTGACCACATGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006283.1-2469s1c1
Sequence:CCGGCAGGATTACTTAGCCAGAGTTCTCGAGAACTCTGGCTAAGTAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006283.1-2294s1c1
Sequence:CCGGGACAAGTATGACCTCTCAGAACTCGAGTTCTGAGAGGTCATACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006283.1-1391s1c1
Sequence:CCGGCATCAGTAAGTCAGCAGGTTTCTCGAGAAACCTGCTGACTTACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006283.1-5623s1c1
Sequence:CCGGGCCAAAGTGTAGATAGCCTTTCTCGAGAAAGGCTATCTACACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1747s21c1
Sequence:CCGGGAAGGCAAAGTCGCGTTTAATCTCGAGATTAAACGCGACTTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006283.2-5690s21c1
Sequence:CCGGGCCAAAGTGTAGATAGCCTTTCTCGAGAAAGGCTATCTACACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006283.2-1911s21c1
Sequence:CCGGCCACGTCATGTGGTCAGAAATCTCGAGATTTCTGACCACATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1000s21c1
Sequence:CCGGCTCCGCAGAAGCTGATCTAAACTCGAGTTTAGATCAGCTTCTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006283.2-1450s21c1
Sequence:CCGGCATCAGTAAGTCAGCAGGTTTCTCGAGAAACCTGCTGACTTACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199323
TACC1 MISSION shRNA Bacterial Glycerol Stock
transforming, acidic coiled-coil containing protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199323.1-6154s1c1
Sequence:CCGGGCCAAGTGTTTATTGCACATTCTCGAGAATGTGCAATAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-711s1c1
Sequence:CCGGCGAAGCAAATGAATGGAAGAACTCGAGTTCTTCCATTCATTTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-675s1c1
Sequence:CCGGCACGTTGATCAGAGAAGAGATCTCGAGATCTCTTCTCTGATCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-677s1c1
Sequence:CCGGCGTTGATCAGAGAAGAGATAACTCGAGTTATCTCTTCTCTGATCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-833s1c1
Sequence:CCGGGCATGAGTTCTCAGAAGAGTTCTCGAGAACTCTTCTGAGAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199323
TACC1 MISSION shRNA shRNA Plasmid DNA
transforming, acidic coiled-coil containing protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199323.1-6154s1c1
Sequence:CCGGGCCAAGTGTTTATTGCACATTCTCGAGAATGTGCAATAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-711s1c1
Sequence:CCGGCGAAGCAAATGAATGGAAGAACTCGAGTTCTTCCATTCATTTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-675s1c1
Sequence:CCGGCACGTTGATCAGAGAAGAGATCTCGAGATCTCTTCTCTGATCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-677s1c1
Sequence:CCGGCGTTGATCAGAGAAGAGATAACTCGAGTTATCTCTTCTCTGATCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-833s1c1
Sequence:CCGGGCATGAGTTCTCAGAAGAGTTCTCGAGAACTCTTCTGAGAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199323
TACC1 MISSION shRNA Lentiviral Transduction Particles
transforming, acidic coiled-coil containing protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199323.1-6154s1c1
Sequence:CCGGGCCAAGTGTTTATTGCACATTCTCGAGAATGTGCAATAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-711s1c1
Sequence:CCGGCGAAGCAAATGAATGGAAGAACTCGAGTTCTTCCATTCATTTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-675s1c1
Sequence:CCGGCACGTTGATCAGAGAAGAGATCTCGAGATCTCTTCTCTGATCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-677s1c1
Sequence:CCGGCGTTGATCAGAGAAGAGATAACTCGAGTTATCTCTTCTCTGATCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199323.1-833s1c1
Sequence:CCGGGCATGAGTTCTCAGAAGAGTTCTCGAGAACTCTTCTGAGAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks