EMAIL THIS PAGE TO A FRIEND

TACC2

transforming, acidic coiled-coil containing protein 2

Synonyms: AZU-1 ECTACC
Gene ID:
Human(10579) Summary: Transforming acidic coiled-coil proteins are a conserved family of centrosome- and microtubule-interacting proteins that are implicated in cancer. This gene encodes a protein that concentrates at centrosomes throughout the cell cycle. This gene lies within a chromosomal region associated with tumorigenesis. Expression of this gene is induced by erythropoietin and is thought to affect the progression of breast tumors. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(57752) transforming, acidic coiled-coil containing protein 2
Rat(309025) transforming, acidic coiled-coil containing protein 2
Zebrafish(321181) transforming, acidic coiled-coil containing protein 2
dog(477850) transforming, acidic coiled-coil containing protein 2
domestic cat(101090968) transforming, acidic coiled-coil containing protein 2
Horse(100064696) transforming, acidic coiled-coil containing protein 2
chicken(423939) transforming, acidic coiled-coil containing protein 2
domestic guinea pig(100716789) transforming, acidic coiled-coil containing protein 2
naked mole-rat(101705082) transforming, acidic coiled-coil containing protein 2
Domestic Rabbit(100357089) transforming, acidic coiled-coil containing protein 2
cow(533768) transforming, acidic coiled-coil containing protein 2
sheep(101123429) transforming, acidic coiled-coil containing protein 2
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006997 Rosetta Predictions human pricing
NM_206860 Rosetta Predictions human pricing
NM_206861 Rosetta Predictions human pricing
NM_206862 Rosetta Predictions human pricing
NM_001004415 Rosetta Predictions rat pricing
NM_001004418 Rosetta Predictions rat pricing
NM_001004468 Rosetta Predictions mouse pricing
NM_021314 Rosetta Predictions mouse pricing
NM_206856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058069 predicted 3358
2 SASI_Hs01_00058070 predicted 682
3 SASI_Hs01_00058071 predicted 670
4 SASI_Hs01_00058072 predicted 3102
5 SASI_Hs01_00058073 predicted 2135
6 SASI_Hs01_00058074 predicted 3215
7 SASI_Hs01_00058075 predicted 1566
8 SASI_Hs01_00058076 predicted 1559
9 SASI_Hs01_00058077 predicted 2086
10 SASI_Hs01_00058078 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148435 predicted 3272
2 SASI_Hs01_00148436 predicted 676
3 SASI_Hs01_00148437 predicted 663
4 SASI_Hs01_00148438 predicted 3012
5 SASI_Hs01_00148439 predicted 2132
6 SASI_Hs01_00148440 predicted 3123
7 SASI_Hs01_00148441 predicted 1569
8 SASI_Hs01_00148442 predicted 1559
9 SASI_Hs01_00148443 predicted 2083
10 SASI_Hs01_00148444 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066998 predicted 3588
2 SASI_Hs01_00066999 predicted 906
3 SASI_Hs01_00067000 predicted 892
4 SASI_Hs01_00067001 predicted 3327
5 SASI_Hs01_00067002 predicted 2359
6 SASI_Hs01_00067003 predicted 3435
7 SASI_Hs01_00067004 predicted 1792
8 SASI_Hs01_00067005 predicted 1793
9 SASI_Hs01_00067006 predicted 2316
10 SASI_Hs01_00067007 predicted 1714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088158 predicted 9145
2 SASI_Hs01_00088159 predicted 6474
3 SASI_Hs01_00088160 predicted 6460
4 SASI_Hs01_00088161 predicted 8886
5 SASI_Hs01_00088162 predicted 7923
6 SASI_Hs01_00088163 predicted 9004
7 SASI_Hs01_00088164 predicted 7356
8 SASI_Hs01_00088165 predicted 7351
9 SASI_Hs01_00088166 predicted 7880
10 SASI_Hs01_00088167 predicted 7274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094927 predicted 6765
2 SASI_Rn02_00198332 predicted 8027
3 SASI_Rn01_00094929 predicted 6525
4 SASI_Rn01_00094930 predicted 7378
5 SASI_Rn01_00094931 predicted 7155
6 SASI_Rn01_00094932 predicted 7309
7 SASI_Rn01_00094933 predicted 6887
8 SASI_Rn01_00094935 predicted 7597
9 SASI_Rn02_00198333 predicted 5853
10 SASI_Rn02_00198334 predicted 6067
11 SASI_Rn01_00094928 predicted 7957
12 SASI_Rn01_00094934 predicted 7699
13 SASI_Rn01_00094936 predicted 7325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109104 predicted 1646
2 SASI_Rn02_00198335 predicted 2916
3 SASI_Rn01_00109106 predicted 1414
4 SASI_Rn01_00109107 predicted 2266
5 SASI_Rn01_00109108 predicted 2041
6 SASI_Rn01_00109109 predicted 2196
7 SASI_Rn01_00109110 predicted 1771
8 SASI_Rn01_00109112 predicted 2476
9 SASI_Rn02_00198336 predicted 743
10 SASI_Rn02_00198337 predicted 948
11 SASI_Rn01_00109105 predicted 2841
12 SASI_Rn01_00109111 predicted 2581
13 SASI_Rn01_00109113 predicted 2204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024036 predicted 7764
2 SASI_Mm01_00024038 predicted 5951
3 SASI_Mm01_00024039 predicted 5851
4 SASI_Mm02_00286549 predicted 8437
5 SASI_Mm01_00024040 predicted 6679
6 SASI_Mm01_00024041 predicted 6971
7 SASI_Mm01_00024042 predicted 7839
8 SASI_Mm01_00024043 predicted 8150
9 SASI_Mm01_00024044 predicted 8723
10 SASI_Mm01_00024045 predicted 6611
11 SASI_Mm01_00024037 predicted 7944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063673 predicted 2603
2 SASI_Mm01_00063675 predicted 862
3 SASI_Mm01_00063676 predicted 772
4 SASI_Mm02_00325866 predicted 3270
5 SASI_Mm01_00063677 predicted 1591
6 SASI_Mm01_00063678 predicted 1882
7 SASI_Mm01_00063679 predicted 2667
8 SASI_Mm01_00063680 predicted 2984
9 SASI_Mm01_00063681 predicted 3556
10 SASI_Mm01_00063682 predicted 1521
11 SASI_Mm01_00063674 predicted 2776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152840 predicted 2567
2 SASI_Mm01_00152842 predicted 829
3 SASI_Mm01_00152843 predicted 736
4 SASI_Mm02_00351822 predicted 3236
5 SASI_Mm01_00152844 predicted 1562
6 SASI_Mm01_00152845 predicted 1849
7 SASI_Mm01_00152846 predicted 2635
8 SASI_Mm01_00152847 predicted 2950
9 SASI_Mm01_00152848 predicted 3522
10 SASI_Mm01_00152849 predicted 1481
11 SASI_Mm01_00152841 predicted 2745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021314
VALIDATED
TACC2 MISSION shRNA Bacterial Glycerol Stock
transforming, acidic coiled-coil containing protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2124s21c1
Sequence:CCGGCGGACCTGTCTAACTTTGTAACTCGAGTTACAAAGTTAGACAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2176s21c1
Sequence:CCGGGCTGGACTACAGAAACTCCTACTCGAGTAGGAGTTTCTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2376s21c1
Sequence:CCGGCCCTTGTGAATGCAGCAACAACTCGAGTTGTTGCTGCATTCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021314.4-3559s21c1
Sequence:CCGGCGTCTCCTTTCACTTCCGTATCTCGAGATACGGAAGTGAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-3559s1c1
Sequence:CCGGCGTCTCCTTTCACTTCCGTATCTCGAGATACGGAAGTGAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-700s1c1
Sequence:CCGGCGGGACTTACAACTTAGACTTCTCGAGAAGTCTAAGTTGTAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2376s1c1
Sequence:CCGGCCCTTGTGAATGCAGCAACAACTCGAGTTGTTGCTGCATTCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2176s1c1
Sequence:CCGGGCTGGACTACAGAAACTCCTACTCGAGTAGGAGTTTCTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2124s1c1
Sequence:CCGGCGGACCTGTCTAACTTTGTAACTCGAGTTACAAAGTTAGACAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021314
VALIDATED
TACC2 MISSION shRNA shRNA Plasmid DNA
transforming, acidic coiled-coil containing protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2124s21c1
Sequence:CCGGCGGACCTGTCTAACTTTGTAACTCGAGTTACAAAGTTAGACAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2176s21c1
Sequence:CCGGGCTGGACTACAGAAACTCCTACTCGAGTAGGAGTTTCTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2376s21c1
Sequence:CCGGCCCTTGTGAATGCAGCAACAACTCGAGTTGTTGCTGCATTCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021314.4-3559s21c1
Sequence:CCGGCGTCTCCTTTCACTTCCGTATCTCGAGATACGGAAGTGAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-3559s1c1
Sequence:CCGGCGTCTCCTTTCACTTCCGTATCTCGAGATACGGAAGTGAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-700s1c1
Sequence:CCGGCGGGACTTACAACTTAGACTTCTCGAGAAGTCTAAGTTGTAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2376s1c1
Sequence:CCGGCCCTTGTGAATGCAGCAACAACTCGAGTTGTTGCTGCATTCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2176s1c1
Sequence:CCGGGCTGGACTACAGAAACTCCTACTCGAGTAGGAGTTTCTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2124s1c1
Sequence:CCGGCGGACCTGTCTAACTTTGTAACTCGAGTTACAAAGTTAGACAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021314
VALIDATED
TACC2 MISSION shRNA Lentiviral Transduction Particles
transforming, acidic coiled-coil containing protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2124s21c1
Sequence:CCGGCGGACCTGTCTAACTTTGTAACTCGAGTTACAAAGTTAGACAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2176s21c1
Sequence:CCGGGCTGGACTACAGAAACTCCTACTCGAGTAGGAGTTTCTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021314.4-2376s21c1
Sequence:CCGGCCCTTGTGAATGCAGCAACAACTCGAGTTGTTGCTGCATTCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021314.4-3559s21c1
Sequence:CCGGCGTCTCCTTTCACTTCCGTATCTCGAGATACGGAAGTGAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-3559s1c1
Sequence:CCGGCGTCTCCTTTCACTTCCGTATCTCGAGATACGGAAGTGAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-700s1c1
Sequence:CCGGCGGGACTTACAACTTAGACTTCTCGAGAAGTCTAAGTTGTAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2376s1c1
Sequence:CCGGCCCTTGTGAATGCAGCAACAACTCGAGTTGTTGCTGCATTCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2176s1c1
Sequence:CCGGGCTGGACTACAGAAACTCCTACTCGAGTAGGAGTTTCTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021314.3-2124s1c1
Sequence:CCGGCGGACCTGTCTAACTTTGTAACTCGAGTTACAAAGTTAGACAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006997
VALIDATED
TACC2 MISSION shRNA Bacterial Glycerol Stock
transforming, acidic coiled-coil containing protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-2548s21c1
Sequence:CCGGACTATCTGGAGCCCGACTTAGCTCGAGCTAAGTCGGGCTCCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-2949s21c1
Sequence:CCGGGCTCAGATGATAGAGGACGAACTCGAGTTCGTCCTCTATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-923s21c1
Sequence:CCGGCAGTGCTTCTAGTACCCTTAACTCGAGTTAAGGGTACTAGAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006997.2-3523s21c1
Sequence:CCGGCACTACTGTATTTCCTTTCTACTCGAGTAGAAAGGAAATACAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006997.2-3523s1c1
Sequence:CCGGCACTACTGTATTTCCTTTCTACTCGAGTAGAAAGGAAATACAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006997.2-2949s1c1
Sequence:CCGGGCTCAGATGATAGAGGACGAACTCGAGTTCGTCCTCTATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006997.2-922s1c1
Sequence:CCGGGCAGTGCTTCTAGTACCCTTACTCGAGTAAGGGTACTAGAAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006997.2-923s1c1
Sequence:CCGGCAGTGCTTCTAGTACCCTTAACTCGAGTTAAGGGTACTAGAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006997.2-1843s1c1
Sequence:CCGGCCCTAAAGACTGACACATTTACTCGAGTAAATGTGTCAGTCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006997
VALIDATED
TACC2 MISSION shRNA shRNA Plasmid DNA
transforming, acidic coiled-coil containing protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-2548s21c1
Sequence:CCGGACTATCTGGAGCCCGACTTAGCTCGAGCTAAGTCGGGCTCCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-2949s21c1
Sequence:CCGGGCTCAGATGATAGAGGACGAACTCGAGTTCGTCCTCTATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-923s21c1
Sequence:CCGGCAGTGCTTCTAGTACCCTTAACTCGAGTTAAGGGTACTAGAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006997.2-3523s21c1
Sequence:CCGGCACTACTGTATTTCCTTTCTACTCGAGTAGAAAGGAAATACAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006997.2-3523s1c1
Sequence:CCGGCACTACTGTATTTCCTTTCTACTCGAGTAGAAAGGAAATACAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006997.2-2949s1c1
Sequence:CCGGGCTCAGATGATAGAGGACGAACTCGAGTTCGTCCTCTATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006997.2-922s1c1
Sequence:CCGGGCAGTGCTTCTAGTACCCTTACTCGAGTAAGGGTACTAGAAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006997.2-923s1c1
Sequence:CCGGCAGTGCTTCTAGTACCCTTAACTCGAGTTAAGGGTACTAGAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006997.2-1843s1c1
Sequence:CCGGCCCTAAAGACTGACACATTTACTCGAGTAAATGTGTCAGTCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006997
VALIDATED
TACC2 MISSION shRNA Lentiviral Transduction Particles
transforming, acidic coiled-coil containing protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-2548s21c1
Sequence:CCGGACTATCTGGAGCCCGACTTAGCTCGAGCTAAGTCGGGCTCCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-2949s21c1
Sequence:CCGGGCTCAGATGATAGAGGACGAACTCGAGTTCGTCCTCTATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006997.2-923s21c1
Sequence:CCGGCAGTGCTTCTAGTACCCTTAACTCGAGTTAAGGGTACTAGAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006997.2-3523s21c1
Sequence:CCGGCACTACTGTATTTCCTTTCTACTCGAGTAGAAAGGAAATACAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006997.2-3523s1c1
Sequence:CCGGCACTACTGTATTTCCTTTCTACTCGAGTAGAAAGGAAATACAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006997.2-2949s1c1
Sequence:CCGGGCTCAGATGATAGAGGACGAACTCGAGTTCGTCCTCTATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006997.2-922s1c1
Sequence:CCGGGCAGTGCTTCTAGTACCCTTACTCGAGTAAGGGTACTAGAAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006997.2-923s1c1
Sequence:CCGGCAGTGCTTCTAGTACCCTTAACTCGAGTTAAGGGTACTAGAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006997.2-1843s1c1
Sequence:CCGGCCCTAAAGACTGACACATTTACTCGAGTAAATGTGTCAGTCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks