EMAIL THIS PAGE TO A FRIEND

TACC3

transforming, acidic coiled-coil containing protein 3

Synonyms: ERIC-1 ERIC1
UniProtKB ID: Q9Y6A5, Q3KQS5, Q9UMQ1
Gene ID:
Human(10460) Summary: This gene encodes a member of the transforming acidic colied-coil protein family. The encoded protein is a motor spindle protein that may play a role in stabilization of the mitotic spindle. This protein may also play a role in growth a differentiation of certain cancer cells. [provided by RefSeq, Nov 2011]
Mouse(21335) transforming, acidic coiled-coil containing protein 3
Rat(360962) transforming, acidic coiled-coil containing protein 3
cow(506194) transforming, acidic coiled-coil containing protein 3
sheep(101104153) transforming, acidic coiled-coil containing protein 3
Domestic Rabbit(100008889) transforming, acidic coiled-coil containing protein 3
naked mole-rat(101716366) transforming, acidic coiled-coil containing protein 3
domestic guinea pig(100732392) transforming, acidic coiled-coil containing protein 3
Zebrafish(321283) transforming, acidic coiled-coil containing protein 3
Horse(100052628) transforming, acidic coiled-coil containing protein 3
domestic cat(101082651) transforming, acidic coiled-coil containing protein 3
dog(479079) transforming, acidic coiled-coil containing protein 3
chicken(422899) transforming, acidic coiled-coil containing protein 3
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006342 Rosetta Predictions human pricing
NM_001004424 Rosetta Predictions rat pricing
NM_001040435 Rosetta Predictions mouse pricing
NM_011524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156991 predicted 1728
2 SASI_Hs01_00156992 predicted 656
3 SASI_Hs01_00156993 predicted 330
4 SASI_Hs02_00341376 predicted 1728
5 SASI_Hs01_00156994 predicted 2231
6 SASI_Hs01_00156995 predicted 441
7 SASI_Hs01_00156996 predicted 1750
8 SASI_Hs02_00341377 predicted 207
9 SASI_Hs01_00156998 predicted 582
10 SASI_Hs02_00341378 predicted 1990
11 SASI_Hs01_00156997 predicted 2243
12 SASI_Hs01_00156999 predicted 349
13 SASI_Hs01_00157000 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110224 predicted 1385
2 SASI_Rn01_00110225 predicted 1264
3 SASI_Rn01_00110227 predicted 1512
4 SASI_Rn02_00198338 predicted 1393
5 SASI_Rn01_00110228 predicted 235
6 SASI_Rn02_00198339 predicted 1386
7 SASI_Rn01_00110229 predicted 1042
8 SASI_Rn01_00110230 predicted 1492
9 SASI_Rn01_00110231 predicted 1704
10 SASI_Rn02_00198340 predicted 1551
11 SASI_Rn01_00110226 predicted 355
12 SASI_Rn01_00110232 predicted 993
13 SASI_Rn01_00110233 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138890 predicted 727
2 SASI_Mm02_00290317 predicted 1572
3 SASI_Mm02_00290318 predicted 2015
4 SASI_Mm02_00290319 predicted 952
5 SASI_Mm02_00290320 predicted 1618
6 SASI_Mm02_00290321 predicted 1261
7 SASI_Mm02_00290322 predicted 2078
8 SASI_Mm01_00138893 predicted 802
9 SASI_Mm02_00290323 predicted 2134
10 SASI_Mm02_00290324 predicted 1194
11 SASI_Mm01_00138891 predicted 289
12 SASI_Mm01_00138892 predicted 335
13 SASI_Mm01_00138894 predicted 314
14 SASI_Mm01_00138895 predicted 265
15 SASI_Mm01_00138896 predicted 321
16 SASI_Mm01_00138897 predicted 265
17 SASI_Mm01_00138898 predicted 263
18 SASI_Mm01_00138899 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051319 predicted 225
2 SASI_Mm01_00051320 predicted 245
3 SASI_Mm01_00051321 predicted 280
4 SASI_Mm01_00051322 predicted 295
5 SASI_Mm01_00051323 predicted 258
6 SASI_Mm01_00051324 predicted 215
7 SASI_Mm01_00051325 predicted 272
8 SASI_Mm01_00051326 predicted 209
9 SASI_Mm01_00051327 predicted 214
10 SASI_Mm01_00051328 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011524
VALIDATED
TACC3 MISSION shRNA Bacterial Glycerol Stock
transforming, acidic coiled-coil containing protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-851s1c1
Sequence:CCGGGCAGTCTTTGTACGTGAAATTCTCGAGAATTTCACGTACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-978s1c1
Sequence:CCGGGCTGAGCTTGTCAACTTAGATCTCGAGATCTAAGTTGACAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-991s1c1
Sequence:CCGGACTTAGATTTCTTGGGAGATTCTCGAGAATCTCCCAAGAAATCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-1748s1c1
Sequence:CCGGCCCATTTATTTCCTTATCTGTCTCGAGACAGATAAGGAAATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-1319s1c1
Sequence:CCGGCCAACTTAATGCAGACCTGAACTCGAGTTCAGGTCTGCATTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011524
VALIDATED
TACC3 MISSION shRNA shRNA Plasmid DNA
transforming, acidic coiled-coil containing protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-851s1c1
Sequence:CCGGGCAGTCTTTGTACGTGAAATTCTCGAGAATTTCACGTACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-978s1c1
Sequence:CCGGGCTGAGCTTGTCAACTTAGATCTCGAGATCTAAGTTGACAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-991s1c1
Sequence:CCGGACTTAGATTTCTTGGGAGATTCTCGAGAATCTCCCAAGAAATCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-1748s1c1
Sequence:CCGGCCCATTTATTTCCTTATCTGTCTCGAGACAGATAAGGAAATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-1319s1c1
Sequence:CCGGCCAACTTAATGCAGACCTGAACTCGAGTTCAGGTCTGCATTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011524
VALIDATED
TACC3 MISSION shRNA Lentiviral Transduction Particles
transforming, acidic coiled-coil containing protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-851s1c1
Sequence:CCGGGCAGTCTTTGTACGTGAAATTCTCGAGAATTTCACGTACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-978s1c1
Sequence:CCGGGCTGAGCTTGTCAACTTAGATCTCGAGATCTAAGTTGACAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-991s1c1
Sequence:CCGGACTTAGATTTCTTGGGAGATTCTCGAGAATCTCCCAAGAAATCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-1748s1c1
Sequence:CCGGCCCATTTATTTCCTTATCTGTCTCGAGACAGATAAGGAAATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011524.1-1319s1c1
Sequence:CCGGCCAACTTAATGCAGACCTGAACTCGAGTTCAGGTCTGCATTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006342
VALIDATED
TACC3 MISSION shRNA Bacterial Glycerol Stock
transforming, acidic coiled-coil containing protein 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-589s1c1
Sequence:CCGGCCAGGAAGTTCTGAGAACCAACTCGAGTTGGTTCTCAGAACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006342.1-1905s1c1
Sequence:CCGGGCTTGTGGAGTTCGATTTCTTCTCGAGAAGAAATCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-305s1c1
Sequence:CCGGCGCACAGGATTCTAAGTCCTACTCGAGTAGGACTTAGAATCCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-1776s1c1
Sequence:CCGGGCAGTCCTTATACCTCAAGTTCTCGAGAACTTGAGGTATAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006342.1-2629s1c1
Sequence:CCGGCCACGGAGCCGCTGTCCCCGCCTCGAGGCGGGGACAGCGGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-300s21c1
Sequence:CCGGACAGACGCACAGGATTCTAAGCTCGAGCTTAGAATCCTGTGCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1905s21c1
Sequence:CCGGGCTTGTGGAGTTCGATTTCTTCTCGAGAAGAAATCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1737s21c1
Sequence:CCGGGTTTGGAACTTCCTCGTTTAACTCGAGTTAAACGAGGAAGTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-2205s21c1
Sequence:CCGGTGAAATCCAGAAAGTTCTAAACTCGAGTTTAGAACTTTCTGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1852s21c1
Sequence:CCGGAGCAGCATGCACGGTGCAAATCTCGAGATTTGCACCGTGCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1768s21c1
Sequence:CCGGTTGAGGAAGCAGTCCTTATACCTCGAGGTATAAGGACTGCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1068s21c1
Sequence:CCGGAGAAGTGGCTGCAGGCCAAATCTCGAGATTTGGCCTGCAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006342
VALIDATED
TACC3 MISSION shRNA shRNA Plasmid DNA
transforming, acidic coiled-coil containing protein 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-589s1c1
Sequence:CCGGCCAGGAAGTTCTGAGAACCAACTCGAGTTGGTTCTCAGAACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006342.1-1905s1c1
Sequence:CCGGGCTTGTGGAGTTCGATTTCTTCTCGAGAAGAAATCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-305s1c1
Sequence:CCGGCGCACAGGATTCTAAGTCCTACTCGAGTAGGACTTAGAATCCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-1776s1c1
Sequence:CCGGGCAGTCCTTATACCTCAAGTTCTCGAGAACTTGAGGTATAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006342.1-2629s1c1
Sequence:CCGGCCACGGAGCCGCTGTCCCCGCCTCGAGGCGGGGACAGCGGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-300s21c1
Sequence:CCGGACAGACGCACAGGATTCTAAGCTCGAGCTTAGAATCCTGTGCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1905s21c1
Sequence:CCGGGCTTGTGGAGTTCGATTTCTTCTCGAGAAGAAATCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1737s21c1
Sequence:CCGGGTTTGGAACTTCCTCGTTTAACTCGAGTTAAACGAGGAAGTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-2205s21c1
Sequence:CCGGTGAAATCCAGAAAGTTCTAAACTCGAGTTTAGAACTTTCTGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1852s21c1
Sequence:CCGGAGCAGCATGCACGGTGCAAATCTCGAGATTTGCACCGTGCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1768s21c1
Sequence:CCGGTTGAGGAAGCAGTCCTTATACCTCGAGGTATAAGGACTGCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1068s21c1
Sequence:CCGGAGAAGTGGCTGCAGGCCAAATCTCGAGATTTGGCCTGCAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006342
VALIDATED
TACC3 MISSION shRNA Lentiviral Transduction Particles
transforming, acidic coiled-coil containing protein 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-589s1c1
Sequence:CCGGCCAGGAAGTTCTGAGAACCAACTCGAGTTGGTTCTCAGAACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006342.1-1905s1c1
Sequence:CCGGGCTTGTGGAGTTCGATTTCTTCTCGAGAAGAAATCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-305s1c1
Sequence:CCGGCGCACAGGATTCTAAGTCCTACTCGAGTAGGACTTAGAATCCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006342.1-1776s1c1
Sequence:CCGGGCAGTCCTTATACCTCAAGTTCTCGAGAACTTGAGGTATAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006342.1-2629s1c1
Sequence:CCGGCCACGGAGCCGCTGTCCCCGCCTCGAGGCGGGGACAGCGGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-300s21c1
Sequence:CCGGACAGACGCACAGGATTCTAAGCTCGAGCTTAGAATCCTGTGCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1905s21c1
Sequence:CCGGGCTTGTGGAGTTCGATTTCTTCTCGAGAAGAAATCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1737s21c1
Sequence:CCGGGTTTGGAACTTCCTCGTTTAACTCGAGTTAAACGAGGAAGTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-2205s21c1
Sequence:CCGGTGAAATCCAGAAAGTTCTAAACTCGAGTTTAGAACTTTCTGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1852s21c1
Sequence:CCGGAGCAGCATGCACGGTGCAAATCTCGAGATTTGCACCGTGCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1768s21c1
Sequence:CCGGTTGAGGAAGCAGTCCTTATACCTCGAGGTATAAGGACTGCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006342.1-1068s21c1
Sequence:CCGGAGAAGTGGCTGCAGGCCAAATCTCGAGATTTGGCCTGCAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040435
VALIDATED
TACC3 MISSION shRNA Bacterial Glycerol Stock
transforming, acidic coiled-coil containing protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040435.2-1744s21c1
Sequence:CCGGGCTGAGCTTGTCAACTTAGATCTCGAGATCTAAGTTGACAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040435.2-1617s21c1
Sequence:CCGGGCAGTCTTTGTACGTGAAATTCTCGAGAATTTCACGTACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-2085s21c1
Sequence:CCGGCCAACTTAATGCAGACCTGAACTCGAGTTCAGGTCTGCATTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-1578s21c1
Sequence:CCGGGTTTGGAACTTCCTCGTTTAACTCGAGTTAAACGAGGAAGTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-1491s21c1
Sequence:CCGGAGAACCTGTCGTGGATCTAAACTCGAGTTTAGATCCACGACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040435
VALIDATED
TACC3 MISSION shRNA shRNA Plasmid DNA
transforming, acidic coiled-coil containing protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040435.2-1744s21c1
Sequence:CCGGGCTGAGCTTGTCAACTTAGATCTCGAGATCTAAGTTGACAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040435.2-1617s21c1
Sequence:CCGGGCAGTCTTTGTACGTGAAATTCTCGAGAATTTCACGTACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-2085s21c1
Sequence:CCGGCCAACTTAATGCAGACCTGAACTCGAGTTCAGGTCTGCATTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-1578s21c1
Sequence:CCGGGTTTGGAACTTCCTCGTTTAACTCGAGTTAAACGAGGAAGTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-1491s21c1
Sequence:CCGGAGAACCTGTCGTGGATCTAAACTCGAGTTTAGATCCACGACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040435
VALIDATED
TACC3 MISSION shRNA Lentiviral Transduction Particles
transforming, acidic coiled-coil containing protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040435.2-1744s21c1
Sequence:CCGGGCTGAGCTTGTCAACTTAGATCTCGAGATCTAAGTTGACAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040435.2-1617s21c1
Sequence:CCGGGCAGTCTTTGTACGTGAAATTCTCGAGAATTTCACGTACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-2085s21c1
Sequence:CCGGCCAACTTAATGCAGACCTGAACTCGAGTTCAGGTCTGCATTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-1578s21c1
Sequence:CCGGGTTTGGAACTTCCTCGTTTAACTCGAGTTAAACGAGGAAGTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040435.2-1491s21c1
Sequence:CCGGAGAACCTGTCGTGGATCTAAACTCGAGTTTAGATCCACGACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks