EMAIL THIS PAGE TO A FRIEND

TACO1

translational activator of mitochondrially encoded cytochrome c oxidase I

Synonyms: CCDC44
UniProtKB ID: Q9BSH4, B2RD21, Q8N3N6, Q9UI60
Gene ID:
Human(51204) Summary: This gene encodes a mitochondrial protein that function as a translational activator of mitochondrially-encoded cytochrome c oxidase 1. Mutations in this gene are associated with Leigh syndrome.[provided by RefSeq, Mar 2010]
Mouse(70207) translational activator of mitochondrially encoded cytochrome c oxidase I
Rat(360645) translational activator of mitochondrially encoded cytochrome c oxidase I
dog(610701) translational activator of mitochondrially encoded cytochrome c oxidase I
cow(507536) translational activator of mitochondrially encoded cytochrome c oxidase I
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016360 Rosetta Predictions human pricing
NM_001108302 Rosetta Predictions rat pricing
XM_340922 Rosetta Predictions rat pricing
NM_027346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193822 predicted 677
2 SASI_Hs01_00193823 predicted 790
3 SASI_Hs01_00193824 predicted 693
4 SASI_Hs01_00193825 predicted 763
5 SASI_Hs01_00193826 predicted 1020
6 SASI_Hs01_00193827 predicted 512
7 SASI_Hs01_00193829 predicted 558
8 SASI_Hs01_00193830 predicted 680
9 SASI_Hs01_00193831 predicted 421
10 SASI_Hs02_00349335 predicted 1135
11 SASI_Hs01_00193828 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237319 predicted 630
2 SASI_Rn02_00237320 predicted 785
3 SASI_Rn02_00237321 predicted 546
4 SASI_Rn02_00237322 predicted 1069
5 SASI_Rn02_00237323 predicted 382
6 SASI_Rn02_00237324 predicted 309
7 SASI_Rn02_00237325 predicted 424
8 SASI_Rn02_00237326 predicted 811
9 SASI_Rn02_00237327 predicted 796
10 SASI_Rn02_00237328 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184856 predicted 621
2 SASI_Rn01_00184857 predicted 593
3 SASI_Rn01_00184858 predicted 401
4 SASI_Rn01_00184859 predicted 504
5 SASI_Rn01_00184860 predicted 729
6 SASI_Rn01_00184861 predicted 538
7 SASI_Rn01_00184862 predicted 617
8 SASI_Rn01_00184863 predicted 590
9 SASI_Rn01_00184864 predicted 827
10 SASI_Rn01_00184865 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032014 predicted 383
2 SASI_Mm01_00032015 predicted 612
3 SASI_Mm01_00032016 predicted 989
4 SASI_Mm01_00032017 predicted 562
5 SASI_Mm01_00032018 predicted 523
6 SASI_Mm01_00032019 predicted 311
7 SASI_Mm01_00032021 predicted 303
8 SASI_Mm01_00032022 predicted 982
9 SASI_Mm01_00032023 predicted 730
10 SASI_Mm02_00332004 predicted 352
11 SASI_Mm01_00032020 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016360
VALIDATED
TACO1 MISSION shRNA Bacterial Glycerol Stock
translational activator of mitochondrially encoded cytochrome c oxidase I
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016360.2-1062s21c1
Sequence:CCGGGATGTGATTCACGTCTATGATCTCGAGATCATAGACGTGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-593s21c1
Sequence:CCGGCAAGGACACTTATTTGCTGTACTCGAGTACAGCAAATAAGTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-433s21c1
Sequence:CCGGGTCGCATCTTCTCCAAACTCTCTCGAGAGAGTTTGGAGAAGATGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-1229s21c1
Sequence:CCGGCGACCTTGAAGCCAAAGGAATCTCGAGATTCCTTTGGCTTCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-433s1c1
Sequence:CCGGGTCGCATCTTCTCCAAACTCTCTCGAGAGAGTTTGGAGAAGATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-1229s1c1
Sequence:CCGGCGACCTTGAAGCCAAAGGAATCTCGAGATTCCTTTGGCTTCAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-593s1c1
Sequence:CCGGCAAGGACACTTATTTGCTGTACTCGAGTACAGCAAATAAGTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016360.2-585s1c1
Sequence:CCGGGAGAAATCCAAGGACACTTATCTCGAGATAAGTGTCCTTGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016360.2-1236s1c1
Sequence:CCGGGAAGCCAAAGGAATCTCACTTCTCGAGAAGTGAGATTCCTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-1062s1c1
Sequence:CCGGGATGTGATTCACGTCTATGATCTCGAGATCATAGACGTGAATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-440s1c1
Sequence:CCGGCTTCTCCAAACTCTGTTTGAACTCGAGTTCAAACAGAGTTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016360
VALIDATED
TACO1 MISSION shRNA shRNA Plasmid DNA
translational activator of mitochondrially encoded cytochrome c oxidase I
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016360.2-1062s21c1
Sequence:CCGGGATGTGATTCACGTCTATGATCTCGAGATCATAGACGTGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-593s21c1
Sequence:CCGGCAAGGACACTTATTTGCTGTACTCGAGTACAGCAAATAAGTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-433s21c1
Sequence:CCGGGTCGCATCTTCTCCAAACTCTCTCGAGAGAGTTTGGAGAAGATGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-1229s21c1
Sequence:CCGGCGACCTTGAAGCCAAAGGAATCTCGAGATTCCTTTGGCTTCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-433s1c1
Sequence:CCGGGTCGCATCTTCTCCAAACTCTCTCGAGAGAGTTTGGAGAAGATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-1229s1c1
Sequence:CCGGCGACCTTGAAGCCAAAGGAATCTCGAGATTCCTTTGGCTTCAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-593s1c1
Sequence:CCGGCAAGGACACTTATTTGCTGTACTCGAGTACAGCAAATAAGTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016360.2-585s1c1
Sequence:CCGGGAGAAATCCAAGGACACTTATCTCGAGATAAGTGTCCTTGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016360.2-1236s1c1
Sequence:CCGGGAAGCCAAAGGAATCTCACTTCTCGAGAAGTGAGATTCCTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-1062s1c1
Sequence:CCGGGATGTGATTCACGTCTATGATCTCGAGATCATAGACGTGAATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-440s1c1
Sequence:CCGGCTTCTCCAAACTCTGTTTGAACTCGAGTTCAAACAGAGTTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016360
VALIDATED
TACO1 MISSION shRNA Lentiviral Transduction Particles
translational activator of mitochondrially encoded cytochrome c oxidase I
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016360.2-1062s21c1
Sequence:CCGGGATGTGATTCACGTCTATGATCTCGAGATCATAGACGTGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-593s21c1
Sequence:CCGGCAAGGACACTTATTTGCTGTACTCGAGTACAGCAAATAAGTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-433s21c1
Sequence:CCGGGTCGCATCTTCTCCAAACTCTCTCGAGAGAGTTTGGAGAAGATGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016360.2-1229s21c1
Sequence:CCGGCGACCTTGAAGCCAAAGGAATCTCGAGATTCCTTTGGCTTCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-433s1c1
Sequence:CCGGGTCGCATCTTCTCCAAACTCTCTCGAGAGAGTTTGGAGAAGATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-1229s1c1
Sequence:CCGGCGACCTTGAAGCCAAAGGAATCTCGAGATTCCTTTGGCTTCAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-593s1c1
Sequence:CCGGCAAGGACACTTATTTGCTGTACTCGAGTACAGCAAATAAGTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016360.2-585s1c1
Sequence:CCGGGAGAAATCCAAGGACACTTATCTCGAGATAAGTGTCCTTGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016360.2-1236s1c1
Sequence:CCGGGAAGCCAAAGGAATCTCACTTCTCGAGAAGTGAGATTCCTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-1062s1c1
Sequence:CCGGGATGTGATTCACGTCTATGATCTCGAGATCATAGACGTGAATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016360.2-440s1c1
Sequence:CCGGCTTCTCCAAACTCTGTTTGAACTCGAGTTCAAACAGAGTTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027346
TACO1 MISSION shRNA Bacterial Glycerol Stock
translational activator of mitochondrially encoded cytochrome c oxidase I
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-976s1c1
Sequence:CCGGGCGCTTAACAACTATGAGGATCTCGAGATCCTCATAGTTGTTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-587s1c1
Sequence:CCGGCGTTATCAAACAGTGGTCCCACTCGAGTGGGACCACTGTTTGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027346.1-1079s1c1
Sequence:CCGGGCAGCAATCTCAGAGACTGAACTCGAGTTCAGTCTCTGAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-525s1c1
Sequence:CCGGCAAGGGCATTTATTTGCTATACTCGAGTATAGCAAATAAATGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027346
TACO1 MISSION shRNA shRNA Plasmid DNA
translational activator of mitochondrially encoded cytochrome c oxidase I
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-976s1c1
Sequence:CCGGGCGCTTAACAACTATGAGGATCTCGAGATCCTCATAGTTGTTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-587s1c1
Sequence:CCGGCGTTATCAAACAGTGGTCCCACTCGAGTGGGACCACTGTTTGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027346.1-1079s1c1
Sequence:CCGGGCAGCAATCTCAGAGACTGAACTCGAGTTCAGTCTCTGAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-525s1c1
Sequence:CCGGCAAGGGCATTTATTTGCTATACTCGAGTATAGCAAATAAATGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027346
TACO1 MISSION shRNA Lentiviral Transduction Particles
translational activator of mitochondrially encoded cytochrome c oxidase I
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-976s1c1
Sequence:CCGGGCGCTTAACAACTATGAGGATCTCGAGATCCTCATAGTTGTTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-587s1c1
Sequence:CCGGCGTTATCAAACAGTGGTCCCACTCGAGTGGGACCACTGTTTGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027346.1-1079s1c1
Sequence:CCGGGCAGCAATCTCAGAGACTGAACTCGAGTTCAGTCTCTGAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027346.1-525s1c1
Sequence:CCGGCAAGGGCATTTATTTGCTATACTCGAGTATAGCAAATAAATGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks