EMAIL THIS PAGE TO A FRIEND

TACR1

tachykinin receptor 1

Synonyms: NK1R NKIR SPR TAC1R
UniProtKB ID: P25103, A8K150
Gene ID:
Human(6869) Summary: This gene belongs to a gene family of tachykinin receptors. These tachykinin receptors are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin substance P, also referred to as neurokinin 1. The encoded protein is also involved in the mediation of phosphatidylinositol metabolism of substance P. [provided by RefSeq, Sep 2008]
Mouse(21336) tachykinin receptor 1
Rat(24807) tachykinin receptor 1
cow(407133) tachykinin receptor 1
sheep(101122011) tachykinin receptor 1
domestic guinea pig(100135626) tachykinin receptor 1
naked mole-rat(101721580) tachykinin receptor 1
Domestic Rabbit(100357296) tachykinin receptor 1
chicken(395677) tachykinin receptor 1
dog(403815) tachykinin receptor 1
domestic cat(101090094) tachykinin receptor 1
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
S3672 [Sar9, Met(O2)11]-Substance P ≥95% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053001 MISSION® esiRNA esiRNA human TACR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001058 Rosetta Predictions human pricing
NM_015727 Rosetta Predictions human pricing
NM_012667 Rosetta Predictions rat pricing
XM_579342 Rosetta Predictions rat pricing
NM_009313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060004 predicted 829
2 SASI_Hs01_00060005 predicted 761
3 SASI_Hs01_00060007 predicted 764
4 SASI_Hs01_00060008 predicted 859
5 SASI_Hs01_00060009 predicted 801
6 SASI_Hs01_00060010 predicted 867
7 SASI_Hs01_00060011 predicted 784
8 SASI_Hs01_00060012 predicted 790
9 SASI_Hs01_00060013 predicted 852
10 SASI_Hs02_00311863 predicted 788
11 SASI_Hs01_00060006 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174309 predicted 744
2 SASI_Hs01_00174310 predicted 664
3 SASI_Hs01_00174312 predicted 683
4 SASI_Hs01_00174313 predicted 762
5 SASI_Hs01_00174314 predicted 711
6 SASI_Hs01_00174315 predicted 782
7 SASI_Hs01_00174316 predicted 690
8 SASI_Hs01_00174317 predicted 699
9 SASI_Hs01_00174318 predicted 768
10 SASI_Hs02_00348418 predicted 694
11 SASI_Hs01_00174311 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071869 predicted 841
2 SASI_Rn01_00071871 predicted 1123
3 SASI_Rn02_00259933 predicted 1972
4 SASI_Rn02_00259934 predicted 2031
5 SASI_Rn01_00071872 predicted 991
6 SASI_Rn02_00259935 predicted 2039
7 SASI_Rn01_00071877 predicted 1866
8 SASI_Rn01_00071874 predicted 1738
9 SASI_Rn02_00259936 predicted 1776
10 SASI_Rn02_00259937 predicted 1810
11 SASI_Rn01_00071870 predicted 778
12 SASI_Rn01_00071873 predicted 1195
13 SASI_Rn01_00071875 predicted 1860
14 SASI_Rn01_00071876 predicted 1762
15 SASI_Rn01_00071878 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158028 predicted 1136
2 SASI_Rn01_00158029 predicted 1142
3 SASI_Rn01_00158030 predicted 1016
4 SASI_Rn01_00158031 predicted 1209
5 SASI_Rn01_00158032 predicted 1459
6 SASI_Rn01_00158033 predicted 1195
7 SASI_Rn01_00158034 predicted 1171
8 SASI_Rn01_00158035 predicted 1306
9 SASI_Rn01_00158036 predicted 1130
10 SASI_Rn01_00158037 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042607 predicted 1411
2 SASI_Mm01_00042608 predicted 1440
3 SASI_Mm01_00042610 predicted 2204
4 SASI_Mm01_00042611 predicted 1484
5 SASI_Mm01_00042612 predicted 2145
6 SASI_Mm02_00315852 predicted 1251
7 SASI_Mm01_00042613 predicted 1348
8 SASI_Mm01_00042614 predicted 1917
9 SASI_Mm01_00042615 predicted 2145
10 SASI_Mm01_00042616 predicted 1537
11 SASI_Mm01_00042609 predicted 1742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001058
TACR1 MISSION shRNA Bacterial Glycerol Stock
tachykinin receptor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001058.2-1480s1c1
Sequence:CCGGCCTCCCTTCATGCATGGAAATCTCGAGATTTCCATGCATGAAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-1213s1c1
Sequence:CCGGGAAATGAAATCCACCCGGTATCTCGAGATACCGGGTGGATTTCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-772s1c1
Sequence:CCGGCCGAACAAGATTTATGAGAAACTCGAGTTTCTCATAAATCTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-360s1c1
Sequence:CCGGCGTGGTAGTGATGTGGATCATCTCGAGATGATCCACATCACTACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001058.3-971s21c1
Sequence:CCGGATAGGTACATGGCCATCATACCTCGAGGTATGATGGCCATGTACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001058.3-774s21c1
Sequence:CCGGGAGGACAGTGACGAACTATTTCTCGAGAAATAGTTCGTCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001058.3-2112s21c1
Sequence:CCGGCTGCATGCGAGTGCTCATTTCCTCGAGGAAATGAGCACTCGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001058
TACR1 MISSION shRNA shRNA Plasmid DNA
tachykinin receptor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001058.2-1480s1c1
Sequence:CCGGCCTCCCTTCATGCATGGAAATCTCGAGATTTCCATGCATGAAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-1213s1c1
Sequence:CCGGGAAATGAAATCCACCCGGTATCTCGAGATACCGGGTGGATTTCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-772s1c1
Sequence:CCGGCCGAACAAGATTTATGAGAAACTCGAGTTTCTCATAAATCTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-360s1c1
Sequence:CCGGCGTGGTAGTGATGTGGATCATCTCGAGATGATCCACATCACTACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001058.3-971s21c1
Sequence:CCGGATAGGTACATGGCCATCATACCTCGAGGTATGATGGCCATGTACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001058.3-774s21c1
Sequence:CCGGGAGGACAGTGACGAACTATTTCTCGAGAAATAGTTCGTCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001058.3-2112s21c1
Sequence:CCGGCTGCATGCGAGTGCTCATTTCCTCGAGGAAATGAGCACTCGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001058
TACR1 MISSION shRNA Lentiviral Transduction Particles
tachykinin receptor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001058.2-1480s1c1
Sequence:CCGGCCTCCCTTCATGCATGGAAATCTCGAGATTTCCATGCATGAAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-1213s1c1
Sequence:CCGGGAAATGAAATCCACCCGGTATCTCGAGATACCGGGTGGATTTCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-772s1c1
Sequence:CCGGCCGAACAAGATTTATGAGAAACTCGAGTTTCTCATAAATCTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001058.2-360s1c1
Sequence:CCGGCGTGGTAGTGATGTGGATCATCTCGAGATGATCCACATCACTACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001058.3-971s21c1
Sequence:CCGGATAGGTACATGGCCATCATACCTCGAGGTATGATGGCCATGTACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001058.3-774s21c1
Sequence:CCGGGAGGACAGTGACGAACTATTTCTCGAGAAATAGTTCGTCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001058.3-2112s21c1
Sequence:CCGGCTGCATGCGAGTGCTCATTTCCTCGAGGAAATGAGCACTCGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009313
TACR1 MISSION shRNA Bacterial Glycerol Stock
tachykinin receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-885s1c2
Sequence:CCGGCTGCAAGTTTCACAACTTCTTCTCGAGAAGAAGTTGTGAAACTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-1009s1c1
Sequence:CCGGGCTACCAAAGTGGTCATCTTTCTCGAGAAAGATGACCACTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-638s1c1
Sequence:CCGGCTAACCAGTTTGTGCAACCTACTCGAGTAGGTTGCACAAACTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009313.4-3835s21c1
Sequence:CCGGTGGAGAAGGCAAGCGTTATATCTCGAGATATAACGCTTGCCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1068s21c1
Sequence:CCGGTAGTGGTGATATGGATCATTTCTCGAGAAATGATCCATATCACCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1105s21c1
Sequence:CCGGGAGGACAGTGACCAATTATTTCTCGAGAAATAATTGGTCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1560s21c1
Sequence:CCGGCATACACTGTGGTAGGGATTACTCGAGTAATCCCTACCACAGTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1479s21c1
Sequence:CCGGCCAACAGGACTTACGAGAAAGCTCGAGCTTTCTCGTAAGTCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009313
TACR1 MISSION shRNA shRNA Plasmid DNA
tachykinin receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-885s1c2
Sequence:CCGGCTGCAAGTTTCACAACTTCTTCTCGAGAAGAAGTTGTGAAACTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-1009s1c1
Sequence:CCGGGCTACCAAAGTGGTCATCTTTCTCGAGAAAGATGACCACTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-638s1c1
Sequence:CCGGCTAACCAGTTTGTGCAACCTACTCGAGTAGGTTGCACAAACTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009313.4-3835s21c1
Sequence:CCGGTGGAGAAGGCAAGCGTTATATCTCGAGATATAACGCTTGCCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1068s21c1
Sequence:CCGGTAGTGGTGATATGGATCATTTCTCGAGAAATGATCCATATCACCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1105s21c1
Sequence:CCGGGAGGACAGTGACCAATTATTTCTCGAGAAATAATTGGTCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1560s21c1
Sequence:CCGGCATACACTGTGGTAGGGATTACTCGAGTAATCCCTACCACAGTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1479s21c1
Sequence:CCGGCCAACAGGACTTACGAGAAAGCTCGAGCTTTCTCGTAAGTCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009313
TACR1 MISSION shRNA Lentiviral Transduction Particles
tachykinin receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-885s1c2
Sequence:CCGGCTGCAAGTTTCACAACTTCTTCTCGAGAAGAAGTTGTGAAACTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-1009s1c1
Sequence:CCGGGCTACCAAAGTGGTCATCTTTCTCGAGAAAGATGACCACTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009313.2-638s1c1
Sequence:CCGGCTAACCAGTTTGTGCAACCTACTCGAGTAGGTTGCACAAACTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009313.4-3835s21c1
Sequence:CCGGTGGAGAAGGCAAGCGTTATATCTCGAGATATAACGCTTGCCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1068s21c1
Sequence:CCGGTAGTGGTGATATGGATCATTTCTCGAGAAATGATCCATATCACCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1105s21c1
Sequence:CCGGGAGGACAGTGACCAATTATTTCTCGAGAAATAATTGGTCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1560s21c1
Sequence:CCGGCATACACTGTGGTAGGGATTACTCGAGTAATCCCTACCACAGTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009313.4-1479s21c1
Sequence:CCGGCCAACAGGACTTACGAGAAAGCTCGAGCTTTCTCGTAAGTCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks