EMAIL THIS PAGE TO A FRIEND

TACR2

tachykinin receptor 2

Synonyms: NK2R NKNAR SKR TAC2R
UniProtKB ID: P21452, A8K7I1, Q4QRI5, Q8NGQ8, Q9UDE6, Q9UDE7
Gene ID:
Human(6865) Summary: This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neuropeptide substance K, also referred to as neurokinin A. [provided by RefSeq, Jul 2008]
Mouse(21337) tachykinin receptor 2
Rat(25007) tachykinin receptor 2
Zebrafish(100002125) tachykinin receptor 2
Horse(100034168) tachykinin receptor 2
domestic cat(101094541) tachykinin receptor 2
chicken(768996) tachykinin receptor 2
dog(489020) tachykinin receptor 2
Domestic Rabbit(100009175) tachykinin receptor 2
naked mole-rat(101709479) tachykinin receptor 2
domestic guinea pig(100720631) tachykinin receptor 2
cow(282088) tachykinin receptor 2
sheep(101108103) tachykinin receptor 2
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
G113 GR 64349 >96% human, mouse, rat pricing
G130 GR 94800 >96%, powder human, mouse, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
L117 L-659,877 >95%, powder human pricing
M157 MEN-10,376 ≥95% (HPLC), solid human pricing
S5192 SB 222200 ≥98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001057 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048521 MISSION® esiRNA esiRNA human TACR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001057 Rosetta Predictions human pricing
NM_080768 Rosetta Predictions rat pricing
NM_009314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067335 predicted 968
2 SASI_Hs02_00311858 predicted 600
3 SASI_Hs02_00311859 predicted 1316
4 SASI_Hs01_00067339 predicted 938
5 SASI_Hs01_00067340 predicted 1462
6 SASI_Hs02_00311860 predicted 688
7 SASI_Hs01_00067343 predicted 1386
8 SASI_Hs02_00311861 predicted 597
9 SASI_Hs01_00067344 predicted 1423
10 SASI_Hs02_00311862 predicted 966
11 SASI_Hs01_00067336 predicted 595
12 SASI_Hs01_00067337 predicted 256
13 SASI_Hs01_00067338 predicted 286
14 SASI_Hs01_00067341 predicted 819
15 SASI_Hs01_00067342 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101213 predicted 1494
2 SASI_Rn02_00267292 predicted 694
3 SASI_Rn01_00101216 predicted 648
4 SASI_Rn01_00101217 predicted 1273
5 SASI_Rn01_00101218 predicted 1337
6 SASI_Rn01_00101219 predicted 608
7 SASI_Rn01_00101220 predicted 1092
8 SASI_Rn01_00101221 predicted 1017
9 SASI_Rn02_00267293 predicted 1679
10 SASI_Rn01_00101222 predicted 730
11 SASI_Rn01_00101214 predicted 1188
12 SASI_Rn01_00101215 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168298 predicted 255
2 SASI_Mm01_00168299 predicted 223
3 SASI_Mm01_00168300 predicted 887
4 SASI_Mm01_00168301 predicted 702
5 SASI_Mm01_00168302 predicted 1474
6 SASI_Mm01_00168303 predicted 633
7 SASI_Mm01_00168304 predicted 760
8 SASI_Mm01_00168305 predicted 343
9 SASI_Mm01_00168306 predicted 1441
10 SASI_Mm01_00168307 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009314
TACR2 MISSION shRNA Bacterial Glycerol Stock
tachykinin receptor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009314.4-572s21c1
Sequence:CCGGGCGCACGGTCACCAACTATTTCTCGAGAAATAGTTGGTGACCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009314.4-1796s21c1
Sequence:CCGGAGTTGTCTCCCGGGAGTATAGCTCGAGCTATACTCCCGGGAGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009314.4-1702s21c1
Sequence:CCGGGAGAGCAGACACCCATCATAGCTCGAGCTATGATGGGTGTCTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009314.4-967s21c1
Sequence:CCGGTGTATCATCTGGTGGTGTTTGCTCGAGCAAACACCACCAGATGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009314.2-1356s1c1
Sequence:CCGGCCACAGGCAATGCTGATACAACTCGAGTTGTATCAGCATTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-703s1c1
Sequence:CCGGCCTGCAGCTTACAGTGTCATTCTCGAGAATGACACTGTAAGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-895s1c1
Sequence:CCGGGACATCTACTACCGCAAGTTTCTCGAGAAACTTGCGGTAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-621s1c1
Sequence:CCGGCAATGACAACGGAGGCAAGATCTCGAGATCTTGCCTCCGTTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-345s1c1
Sequence:CCGGCAGTCACAACATCTGGTACTTCTCGAGAAGTACCAGATGTTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009314
TACR2 MISSION shRNA shRNA Plasmid DNA
tachykinin receptor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009314.4-572s21c1
Sequence:CCGGGCGCACGGTCACCAACTATTTCTCGAGAAATAGTTGGTGACCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009314.4-1796s21c1
Sequence:CCGGAGTTGTCTCCCGGGAGTATAGCTCGAGCTATACTCCCGGGAGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009314.4-1702s21c1
Sequence:CCGGGAGAGCAGACACCCATCATAGCTCGAGCTATGATGGGTGTCTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009314.4-967s21c1
Sequence:CCGGTGTATCATCTGGTGGTGTTTGCTCGAGCAAACACCACCAGATGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009314.2-1356s1c1
Sequence:CCGGCCACAGGCAATGCTGATACAACTCGAGTTGTATCAGCATTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-703s1c1
Sequence:CCGGCCTGCAGCTTACAGTGTCATTCTCGAGAATGACACTGTAAGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-895s1c1
Sequence:CCGGGACATCTACTACCGCAAGTTTCTCGAGAAACTTGCGGTAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-621s1c1
Sequence:CCGGCAATGACAACGGAGGCAAGATCTCGAGATCTTGCCTCCGTTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-345s1c1
Sequence:CCGGCAGTCACAACATCTGGTACTTCTCGAGAAGTACCAGATGTTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009314
TACR2 MISSION shRNA Lentiviral Transduction Particles
tachykinin receptor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009314.4-572s21c1
Sequence:CCGGGCGCACGGTCACCAACTATTTCTCGAGAAATAGTTGGTGACCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009314.4-1796s21c1
Sequence:CCGGAGTTGTCTCCCGGGAGTATAGCTCGAGCTATACTCCCGGGAGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009314.4-1702s21c1
Sequence:CCGGGAGAGCAGACACCCATCATAGCTCGAGCTATGATGGGTGTCTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009314.4-967s21c1
Sequence:CCGGTGTATCATCTGGTGGTGTTTGCTCGAGCAAACACCACCAGATGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009314.2-1356s1c1
Sequence:CCGGCCACAGGCAATGCTGATACAACTCGAGTTGTATCAGCATTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-703s1c1
Sequence:CCGGCCTGCAGCTTACAGTGTCATTCTCGAGAATGACACTGTAAGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-895s1c1
Sequence:CCGGGACATCTACTACCGCAAGTTTCTCGAGAAACTTGCGGTAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-621s1c1
Sequence:CCGGCAATGACAACGGAGGCAAGATCTCGAGATCTTGCCTCCGTTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009314.2-345s1c1
Sequence:CCGGCAGTCACAACATCTGGTACTTCTCGAGAAGTACCAGATGTTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001057
TACR2 MISSION shRNA Bacterial Glycerol Stock
tachykinin receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001057.2-879s21c1
Sequence:CCGGGCCACAACATCTGGTACTTTGCTCGAGCAAAGTACCAGATGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001057.2-849s21c1
Sequence:CCGGTCAATGCCGCCTTCAACTTTGCTCGAGCAAAGTTGAAGGCGGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001057.2-2069s21c1
Sequence:CCGGGCTGCCCAATCTTGGATATTCCTCGAGGAATATCCAAGATTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001057.2-1852s21c1
Sequence:CCGGGGATCCCTTATGAATAGATTACTCGAGTAATCTATTCATAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-259s1c1
Sequence:CCGGGCCGCCTTCAACTTTGTCTATCTCGAGATAGACAAAGTTGAAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-841s1c1
Sequence:CCGGTGCCACAAGTTCATCCAGCAACTCGAGTTGCTGGATGAACTTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-283s1c1
Sequence:CCGGAGCCACAACATCTGGTACTTTCTCGAGAAAGTACCAGATGTTGTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-436s1c1
Sequence:CCGGCCCAGCACCAAGGCGGTTATTCTCGAGAATAACCGCCTTGGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001057
TACR2 MISSION shRNA shRNA Plasmid DNA
tachykinin receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001057.2-879s21c1
Sequence:CCGGGCCACAACATCTGGTACTTTGCTCGAGCAAAGTACCAGATGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001057.2-849s21c1
Sequence:CCGGTCAATGCCGCCTTCAACTTTGCTCGAGCAAAGTTGAAGGCGGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001057.2-2069s21c1
Sequence:CCGGGCTGCCCAATCTTGGATATTCCTCGAGGAATATCCAAGATTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001057.2-1852s21c1
Sequence:CCGGGGATCCCTTATGAATAGATTACTCGAGTAATCTATTCATAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-259s1c1
Sequence:CCGGGCCGCCTTCAACTTTGTCTATCTCGAGATAGACAAAGTTGAAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-841s1c1
Sequence:CCGGTGCCACAAGTTCATCCAGCAACTCGAGTTGCTGGATGAACTTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-283s1c1
Sequence:CCGGAGCCACAACATCTGGTACTTTCTCGAGAAAGTACCAGATGTTGTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-436s1c1
Sequence:CCGGCCCAGCACCAAGGCGGTTATTCTCGAGAATAACCGCCTTGGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001057
TACR2 MISSION shRNA Lentiviral Transduction Particles
tachykinin receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001057.2-879s21c1
Sequence:CCGGGCCACAACATCTGGTACTTTGCTCGAGCAAAGTACCAGATGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001057.2-849s21c1
Sequence:CCGGTCAATGCCGCCTTCAACTTTGCTCGAGCAAAGTTGAAGGCGGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001057.2-2069s21c1
Sequence:CCGGGCTGCCCAATCTTGGATATTCCTCGAGGAATATCCAAGATTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001057.2-1852s21c1
Sequence:CCGGGGATCCCTTATGAATAGATTACTCGAGTAATCTATTCATAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-259s1c1
Sequence:CCGGGCCGCCTTCAACTTTGTCTATCTCGAGATAGACAAAGTTGAAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-841s1c1
Sequence:CCGGTGCCACAAGTTCATCCAGCAACTCGAGTTGCTGGATGAACTTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-283s1c1
Sequence:CCGGAGCCACAACATCTGGTACTTTCTCGAGAAAGTACCAGATGTTGTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001057.1-436s1c1
Sequence:CCGGCCCAGCACCAAGGCGGTTATTCTCGAGAATAACCGCCTTGGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks