EMAIL THIS PAGE TO A FRIEND

TACR3

tachykinin receptor 3

Synonyms: HH11 NK-3R NK3R NKR TAC3RL
UniProtKB ID: P29371, Q0P510
Gene ID:
Human(6870) Summary: This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neurokinin 3, also referred to as neurokinin B. [provided by RefSeq, Jul 2008]
Mouse(21338) tachykinin receptor 3
Rat(24808) tachykinin receptor 3
cow(404136) tachykinin receptor 3
sheep(101121604) tachykinin receptor 3
domestic guinea pig(100135627) tachykinin receptor 3
naked mole-rat(101723093) tachykinin receptor 3
Domestic Rabbit(100008721) tachykinin receptor 3
chicken(768993) tachykinin receptor 3
dog(403814) tachykinin receptor 3
domestic cat(101093603) tachykinin receptor 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S5192 SB 222200 ≥98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001059 Rosetta Predictions human pricing
NM_017053 Rosetta Predictions rat pricing
NM_021382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193035 predicted 641
2 SASI_Hs01_00193036 predicted 696
3 SASI_Hs01_00193038 predicted 499
4 SASI_Hs02_00311864 predicted 736
5 SASI_Hs01_00193039 predicted 1249
6 SASI_Hs01_00193040 predicted 1130
7 SASI_Hs01_00193041 predicted 943
8 SASI_Hs01_00193042 predicted 937
9 SASI_Hs01_00193043 predicted 1075
10 SASI_Hs01_00193044 predicted 683
11 SASI_Hs01_00193037 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068367 predicted 739
2 SASI_Rn01_00068368 predicted 726
3 SASI_Rn01_00068369 predicted 604
4 SASI_Rn02_00261242 predicted 783
5 SASI_Rn02_00261243 predicted 1175
6 SASI_Rn01_00068371 predicted 1357
7 SASI_Rn01_00068372 predicted 706
8 SASI_Rn01_00068373 predicted 827
9 SASI_Rn01_00068374 predicted 1443
10 SASI_Rn01_00068375 predicted 1126
11 SASI_Rn01_00068366 predicted 937
12 SASI_Rn01_00068370 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121238 predicted 1589
2 SASI_Mm01_00121239 predicted 808
3 SASI_Mm01_00121240 predicted 1103
4 SASI_Mm01_00121241 predicted 772
5 SASI_Mm01_00121242 predicted 747
6 SASI_Mm01_00121243 predicted 1129
7 SASI_Mm01_00121244 predicted 790
8 SASI_Mm01_00121245 predicted 1335
9 SASI_Mm01_00121246 predicted 999
10 SASI_Mm01_00121247 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001059
TACR3 MISSION shRNA Bacterial Glycerol Stock
tachykinin receptor 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001059.1-1598s1c1
Sequence:CCGGCCCATTCTCCTATTTATCAGTCTCGAGACTGATAAATAGGAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-549s1c1
Sequence:CCGGGCCTTCAACACGTTGGTCAATCTCGAGATTGACCAACGTGTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-699s1c1
Sequence:CCGGGCTATTATTGATCCCTTGAAACTCGAGTTTCAAGGGATCAATAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-1082s1c1
Sequence:CCGGGCCCTATCATATTTACTTCATCTCGAGATGAAGTAAATATGATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-919s21c1
Sequence:CCGGCATTGCTCATCATGGGTATTACTCGAGTAATACCCATGATGAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-880s21c1
Sequence:CCGGCTTACCATATTATCGTCATTACTCGAGTAATGACGATAATATGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-678s21c1
Sequence:CCGGATTGCGGTGGACAGGTATATGCTCGAGCATATACCTGTCCACCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001059
TACR3 MISSION shRNA shRNA Plasmid DNA
tachykinin receptor 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001059.1-1598s1c1
Sequence:CCGGCCCATTCTCCTATTTATCAGTCTCGAGACTGATAAATAGGAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-549s1c1
Sequence:CCGGGCCTTCAACACGTTGGTCAATCTCGAGATTGACCAACGTGTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-699s1c1
Sequence:CCGGGCTATTATTGATCCCTTGAAACTCGAGTTTCAAGGGATCAATAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-1082s1c1
Sequence:CCGGGCCCTATCATATTTACTTCATCTCGAGATGAAGTAAATATGATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-919s21c1
Sequence:CCGGCATTGCTCATCATGGGTATTACTCGAGTAATACCCATGATGAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-880s21c1
Sequence:CCGGCTTACCATATTATCGTCATTACTCGAGTAATGACGATAATATGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-678s21c1
Sequence:CCGGATTGCGGTGGACAGGTATATGCTCGAGCATATACCTGTCCACCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001059
TACR3 MISSION shRNA Lentiviral Transduction Particles
tachykinin receptor 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001059.1-1598s1c1
Sequence:CCGGCCCATTCTCCTATTTATCAGTCTCGAGACTGATAAATAGGAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-549s1c1
Sequence:CCGGGCCTTCAACACGTTGGTCAATCTCGAGATTGACCAACGTGTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-699s1c1
Sequence:CCGGGCTATTATTGATCCCTTGAAACTCGAGTTTCAAGGGATCAATAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001059.1-1082s1c1
Sequence:CCGGGCCCTATCATATTTACTTCATCTCGAGATGAAGTAAATATGATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-919s21c1
Sequence:CCGGCATTGCTCATCATGGGTATTACTCGAGTAATACCCATGATGAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-880s21c1
Sequence:CCGGCTTACCATATTATCGTCATTACTCGAGTAATGACGATAATATGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001059.1-678s21c1
Sequence:CCGGATTGCGGTGGACAGGTATATGCTCGAGCATATACCTGTCCACCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021382
TACR3 MISSION shRNA Bacterial Glycerol Stock
tachykinin receptor 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021382.2-784s1c1
Sequence:CCGGGCCATTATCGATCCTTTGAAACTCGAGTTTCAAAGGATCGATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021382.2-1877s1c1
Sequence:CCGGCCGGTGTCTGTCATTTAACAACTCGAGTTGTTAAATGACAGACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021382.2-2074s1c1
Sequence:CCGGCCTCAAAGAGTAGGGAGATATCTCGAGATATCTCCCTACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021382.5-1192s1c1
Sequence:CCGGCTGCGATCTACCAACAGTTAACTCGAGTTAACTGTTGGTAGATCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-529s21c1
Sequence:CCGGTCGGAAACCTCATCGTTATTTCTCGAGAAATAACGATGAGGTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-635s21c1
Sequence:CCGGCTTCAACACCTTGGTCAATTTCTCGAGAAATTGACCAAGGTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-1103s21c1
Sequence:CCGGGGCTAAACGAAAGGTTGTAAACTCGAGTTTACAACCTTTCGTTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-962s21c1
Sequence:CCGGCACGTACCACATCATTGTTATCTCGAGATAACAATGATGTGGTACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021382.5-2558s21c1
Sequence:CCGGCATGAACTTTACTGGTTATATCTCGAGATATAACCAGTAAAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021382
TACR3 MISSION shRNA shRNA Plasmid DNA
tachykinin receptor 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021382.2-784s1c1
Sequence:CCGGGCCATTATCGATCCTTTGAAACTCGAGTTTCAAAGGATCGATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021382.2-1877s1c1
Sequence:CCGGCCGGTGTCTGTCATTTAACAACTCGAGTTGTTAAATGACAGACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021382.2-2074s1c1
Sequence:CCGGCCTCAAAGAGTAGGGAGATATCTCGAGATATCTCCCTACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021382.5-1192s1c1
Sequence:CCGGCTGCGATCTACCAACAGTTAACTCGAGTTAACTGTTGGTAGATCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-529s21c1
Sequence:CCGGTCGGAAACCTCATCGTTATTTCTCGAGAAATAACGATGAGGTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-635s21c1
Sequence:CCGGCTTCAACACCTTGGTCAATTTCTCGAGAAATTGACCAAGGTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-1103s21c1
Sequence:CCGGGGCTAAACGAAAGGTTGTAAACTCGAGTTTACAACCTTTCGTTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-962s21c1
Sequence:CCGGCACGTACCACATCATTGTTATCTCGAGATAACAATGATGTGGTACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021382.5-2558s21c1
Sequence:CCGGCATGAACTTTACTGGTTATATCTCGAGATATAACCAGTAAAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021382
TACR3 MISSION shRNA Lentiviral Transduction Particles
tachykinin receptor 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021382.2-784s1c1
Sequence:CCGGGCCATTATCGATCCTTTGAAACTCGAGTTTCAAAGGATCGATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021382.2-1877s1c1
Sequence:CCGGCCGGTGTCTGTCATTTAACAACTCGAGTTGTTAAATGACAGACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021382.2-2074s1c1
Sequence:CCGGCCTCAAAGAGTAGGGAGATATCTCGAGATATCTCCCTACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021382.5-1192s1c1
Sequence:CCGGCTGCGATCTACCAACAGTTAACTCGAGTTAACTGTTGGTAGATCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-529s21c1
Sequence:CCGGTCGGAAACCTCATCGTTATTTCTCGAGAAATAACGATGAGGTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-635s21c1
Sequence:CCGGCTTCAACACCTTGGTCAATTTCTCGAGAAATTGACCAAGGTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-1103s21c1
Sequence:CCGGGGCTAAACGAAAGGTTGTAAACTCGAGTTTACAACCTTTCGTTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021382.5-962s21c1
Sequence:CCGGCACGTACCACATCATTGTTATCTCGAGATAACAATGATGTGGTACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021382.5-2558s21c1
Sequence:CCGGCATGAACTTTACTGGTTATATCTCGAGATATAACCAGTAAAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks