EMAIL THIS PAGE TO A FRIEND

TACSTD2

tumor-associated calcium signal transducer 2

Synonyms: EGP-1 EGP1 GA733-1 GA7331 GP50 M1S1 TROP2
UniProtKB ID: P09758, Q15658, Q6FG48, Q7Z7Q4, Q96QD2
Gene ID:
Human(4070) Summary: This intronless gene encodes a carcinoma-associated antigen. This antigen is a cell surface receptor that transduces calcium signals. Mutations of this gene have been associated with gelatinous drop-like corneal dystrophy.[provided by RefSeq, Dec 2009]
Mouse(56753) tumor-associated calcium signal transducer 2
Rat(494343) tumor-associated calcium signal transducer 2
chicken(772378) tumor-associated calcium signal transducer 2
dog(610286) tumor-associated calcium signal transducer 2
domestic cat(101097004) tumor-associated calcium signal transducer 2
domestic guinea pig(100730427) tumor-associated calcium signal transducer 2
cow(539853) tumor-associated calcium signal transducer 2
sheep(101103277) tumor-associated calcium signal transducer 2
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1760 Human TROP-2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048901 MISSION® esiRNA esiRNA human TACSTD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002353 Rosetta Predictions human pricing
NM_001009540 Rosetta Predictions rat pricing
NM_020047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333686 predicted 1351
2 SASI_Hs01_00072490 predicted 1622
3 SASI_Hs01_00072491 predicted 1402
4 SASI_Hs01_00072493 predicted 1782
5 SASI_Hs01_00072494 predicted 1789
6 SASI_Hs01_00072495 predicted 1108
7 SASI_Hs01_00072497 predicted 1386
8 SASI_Hs01_00072499 predicted 1638
9 SASI_Hs02_00333687 predicted 1654
10 SASI_Hs02_00333688 predicted 1782
11 SASI_Hs01_00072492 predicted 892
12 SASI_Hs01_00072496 predicted 1852
13 SASI_Hs01_00072498 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052329 predicted 1014
2 SASI_Rn01_00052330 predicted 254
3 SASI_Rn01_00052331 predicted 593
4 SASI_Rn01_00052332 predicted 1081
5 SASI_Rn02_00199600 predicted 1074
6 SASI_Rn01_00052333 predicted 1023
7 SASI_Rn01_00052334 predicted 231
8 SASI_Rn02_00199601 predicted 438
9 SASI_Rn01_00052336 predicted 401
10 SASI_Rn01_00052337 predicted 1203
11 SASI_Rn01_00052335 predicted 1092
12 SASI_Rn01_00052338 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109316 predicted 1252
2 SASI_Mm01_00109317 predicted 1054
3 SASI_Mm01_00109318 predicted 1396
4 SASI_Mm01_00109319 predicted 1036
5 SASI_Mm01_00109320 predicted 1305
6 SASI_Mm01_00109321 predicted 676
7 SASI_Mm01_00109322 predicted 1466
8 SASI_Mm01_00109323 predicted 1341
9 SASI_Mm01_00109324 predicted 759
10 SASI_Mm01_00109325 predicted 1358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002353
VALIDATED
TACSTD2 MISSION shRNA Bacterial Glycerol Stock
tumor-associated calcium signal transducer 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002353.2-1289s21c1
Sequence:CCGGGAGAAAGGAACCGAGCTTGTACTCGAGTACAAGCTCGGTTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-953s21c1
Sequence:CCGGGCGGCAGAACACGTCTCAGAACTCGAGTTCTGAGACGTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002353.2-1394s21c1
Sequence:CCGGCGGCGCAAAGGAGACGTTTATCTCGAGATAAACGTCTCCTTTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-1224s21c1
Sequence:CCGGGTGATCACCAACCGGAGAAAGCTCGAGCTTTCTCCGGTTGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-629s21c1
Sequence:CCGGCGTGGACAACGATGGCCTCTACTCGAGTAGAGGCCATCGTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1230s1c1
Sequence:CCGGGCGGCAGAACACGTCTCAGAACTCGAGTTCTGAGACGTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-906s1c1
Sequence:CCGGCGTGGACAACGATGGCCTCTACTCGAGTAGAGGCCATCGTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1287s1c1
Sequence:CCGGCTACTTCGAGAGGGACATCAACTCGAGTTGATGTCCCTCTCGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002353.1-1383s1c1
Sequence:CCGGGCTCATCTATTACCTGGACGACTCGAGTCGTCCAGGTAATAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1566s1c1
Sequence:CCGGGAGAAAGGAACCGAGCTTGTACTCGAGTACAAGCTCGGTTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002353
VALIDATED
TACSTD2 MISSION shRNA shRNA Plasmid DNA
tumor-associated calcium signal transducer 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002353.2-1289s21c1
Sequence:CCGGGAGAAAGGAACCGAGCTTGTACTCGAGTACAAGCTCGGTTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-953s21c1
Sequence:CCGGGCGGCAGAACACGTCTCAGAACTCGAGTTCTGAGACGTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002353.2-1394s21c1
Sequence:CCGGCGGCGCAAAGGAGACGTTTATCTCGAGATAAACGTCTCCTTTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-1224s21c1
Sequence:CCGGGTGATCACCAACCGGAGAAAGCTCGAGCTTTCTCCGGTTGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-629s21c1
Sequence:CCGGCGTGGACAACGATGGCCTCTACTCGAGTAGAGGCCATCGTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1230s1c1
Sequence:CCGGGCGGCAGAACACGTCTCAGAACTCGAGTTCTGAGACGTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-906s1c1
Sequence:CCGGCGTGGACAACGATGGCCTCTACTCGAGTAGAGGCCATCGTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1287s1c1
Sequence:CCGGCTACTTCGAGAGGGACATCAACTCGAGTTGATGTCCCTCTCGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002353.1-1383s1c1
Sequence:CCGGGCTCATCTATTACCTGGACGACTCGAGTCGTCCAGGTAATAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1566s1c1
Sequence:CCGGGAGAAAGGAACCGAGCTTGTACTCGAGTACAAGCTCGGTTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002353
VALIDATED
TACSTD2 MISSION shRNA Lentiviral Transduction Particles
tumor-associated calcium signal transducer 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002353.2-1289s21c1
Sequence:CCGGGAGAAAGGAACCGAGCTTGTACTCGAGTACAAGCTCGGTTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-953s21c1
Sequence:CCGGGCGGCAGAACACGTCTCAGAACTCGAGTTCTGAGACGTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002353.2-1394s21c1
Sequence:CCGGCGGCGCAAAGGAGACGTTTATCTCGAGATAAACGTCTCCTTTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-1224s21c1
Sequence:CCGGGTGATCACCAACCGGAGAAAGCTCGAGCTTTCTCCGGTTGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002353.2-629s21c1
Sequence:CCGGCGTGGACAACGATGGCCTCTACTCGAGTAGAGGCCATCGTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1230s1c1
Sequence:CCGGGCGGCAGAACACGTCTCAGAACTCGAGTTCTGAGACGTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-906s1c1
Sequence:CCGGCGTGGACAACGATGGCCTCTACTCGAGTAGAGGCCATCGTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1287s1c1
Sequence:CCGGCTACTTCGAGAGGGACATCAACTCGAGTTGATGTCCCTCTCGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002353.1-1383s1c1
Sequence:CCGGGCTCATCTATTACCTGGACGACTCGAGTCGTCCAGGTAATAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002353.1-1566s1c1
Sequence:CCGGGAGAAAGGAACCGAGCTTGTACTCGAGTACAAGCTCGGTTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020047
TACSTD2 MISSION shRNA Bacterial Glycerol Stock
tumor-associated calcium signal transducer 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020047.2-1280s1c1
Sequence:CCGGGCTAGATAGCTTGGTTAAGAACTCGAGTTCTTAACCAAGCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-477s1c1
Sequence:CCGGGCACGGACAAGGGAGACCAAACTCGAGTTTGGTCTCCCTTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-1024s1c1
Sequence:CCGGGAGAAGCGAACCTAGCTTGTACTCGAGTACAAGCTAGGTTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-607s1c1
Sequence:CCGGGCTCTTCCAAGAACGCTACAACTCGAGTTGTAGCGTTCTTGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-526s1c1
Sequence:CCGGCCACCACATCCTCATTGAGTTCTCGAGAACTCAATGAGGATGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020047
TACSTD2 MISSION shRNA shRNA Plasmid DNA
tumor-associated calcium signal transducer 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020047.2-1280s1c1
Sequence:CCGGGCTAGATAGCTTGGTTAAGAACTCGAGTTCTTAACCAAGCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-477s1c1
Sequence:CCGGGCACGGACAAGGGAGACCAAACTCGAGTTTGGTCTCCCTTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-1024s1c1
Sequence:CCGGGAGAAGCGAACCTAGCTTGTACTCGAGTACAAGCTAGGTTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-607s1c1
Sequence:CCGGGCTCTTCCAAGAACGCTACAACTCGAGTTGTAGCGTTCTTGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-526s1c1
Sequence:CCGGCCACCACATCCTCATTGAGTTCTCGAGAACTCAATGAGGATGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020047
TACSTD2 MISSION shRNA Lentiviral Transduction Particles
tumor-associated calcium signal transducer 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020047.2-1280s1c1
Sequence:CCGGGCTAGATAGCTTGGTTAAGAACTCGAGTTCTTAACCAAGCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-477s1c1
Sequence:CCGGGCACGGACAAGGGAGACCAAACTCGAGTTTGGTCTCCCTTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-1024s1c1
Sequence:CCGGGAGAAGCGAACCTAGCTTGTACTCGAGTACAAGCTAGGTTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-607s1c1
Sequence:CCGGGCTCTTCCAAGAACGCTACAACTCGAGTTGTAGCGTTCTTGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020047.2-526s1c1
Sequence:CCGGCCACCACATCCTCATTGAGTTCTCGAGAACTCAATGAGGATGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks