EMAIL THIS PAGE TO A FRIEND

TADA1

transcriptional adaptor 1

Synonyms: ADA1 HFI1 RP1-9E21.4 STAF42 TADA1L hADA1
UniProtKB ID: Q96BN2
Gene ID:
Human(117143) Summary: TADA1L is a protein subunit of the human STAGA complex (SPT3; (MIM 602947)/TAF9 (MIM 600822)/GCN5 (MIM 602301) acetyltransferase complex), which is a chromatin-modifying multiprotein complex (Martinez et al., 2001 [PubMed 11564863]
Mouse(27878) transcriptional adaptor 1
Rat(360874) transcriptional adaptor 1
Zebrafish(402899) transcriptional adaptor 1
dog(480090) transcriptional adaptor 1
domestic cat(101097535) transcriptional adaptor 1
cow(521918) transcriptional adaptor 1
sheep(101113550) transcriptional adaptor 1
domestic guinea pig(100734529) transcriptional adaptor 1
naked mole-rat(101720754) transcriptional adaptor 1
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102355 Anti-TADA1L antibody produced in rabbit affinity isolated antibody bovine, mouse, canine, horse, rabbit, human, rat, guinea pig, zebrafish
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053053 Rosetta Predictions human pricing
NM_001037980 Rosetta Predictions rat pricing
XM_001063180 Rosetta Predictions rat pricing
XM_001075782 Rosetta Predictions rat pricing
NM_030245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062988 predicted 513
2 SASI_Hs01_00062989 predicted 667
3 SASI_Hs01_00062990 predicted 670
4 SASI_Hs01_00062991 predicted 540
5 SASI_Hs01_00062992 predicted 333
6 SASI_Hs01_00062993 predicted 856
7 SASI_Hs01_00062994 predicted 579
8 SASI_Hs02_00361896 predicted 1088
9 SASI_Hs01_00062996 predicted 581
10 SASI_Hs01_00062997 predicted 1098
11 SASI_Hs01_00062995 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204658 predicted 985
2 SASI_Rn02_00204659 predicted 639
3 SASI_Rn02_00204660 predicted 989
4 SASI_Rn02_00204661 predicted 923
5 SASI_Rn02_00204662 predicted 491
6 SASI_Rn02_00204663 predicted 974
7 SASI_Rn02_00204664 predicted 651
8 SASI_Rn02_00204665 predicted 1117
9 SASI_Rn02_00204666 predicted 460
10 SASI_Rn02_00204667 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306143 predicted 1148
2 SASI_Rn02_00306144 predicted 1438
3 SASI_Rn02_00306145 predicted 1092
4 SASI_Rn02_00306146 predicted 1438
5 SASI_Rn02_00306147 predicted 1449
6 SASI_Rn02_00306148 predicted 1382
7 SASI_Rn02_00306149 predicted 1310
8 SASI_Rn02_00306150 predicted 1202
9 SASI_Rn02_00306151 predicted 1407
10 SASI_Rn02_00306152 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351021 predicted 1438
2 SASI_Rn02_00351022 predicted 1089
3 SASI_Rn02_00351023 predicted 1439
4 SASI_Rn02_00351024 predicted 636
5 SASI_Rn02_00351025 predicted 1448
6 SASI_Rn02_00351026 predicted 1378
7 SASI_Rn02_00351027 predicted 329
8 SASI_Rn02_00351028 predicted 950
9 SASI_Rn02_00351029 predicted 1436
10 SASI_Rn02_00351030 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084365 predicted 985
2 SASI_Mm01_00084366 predicted 561
3 SASI_Mm01_00084367 predicted 916
4 SASI_Mm01_00084368 predicted 994
5 SASI_Mm01_00084369 predicted 262
6 SASI_Mm01_00084371 predicted 635
7 SASI_Mm01_00084372 predicted 962
8 SASI_Mm01_00084373 predicted 974
9 SASI_Mm02_00336710 predicted 1097
10 SASI_Mm01_00084374 predicted 643
11 SASI_Mm01_00084370 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053053
VALIDATED
TADA1 MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053053.2-663s1c1
Sequence:CCGGGAAGAATAGTGTAGTAGCTTACTCGAGTAAGCTACTACACTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053053.3-256s21c1
Sequence:CCGGACAATACTGGGCTAACCTAAACTCGAGTTTAGGTTAGCCCAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-716s21c1
Sequence:CCGGGCTGTGGAGAATCACCTTAAACTCGAGTTTAAGGTGATTCTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-1903s21c1
Sequence:CCGGGGCAGTTTCTTCGGTTAATTACTCGAGTAATTAACCGAAGAAACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-1100s21c1
Sequence:CCGGACGAAACTCTGGCATCCAAATCTCGAGATTTGGATGCCAGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-775s21c1
Sequence:CCGGTCGGTTACGAGATGGTCATTTCTCGAGAAATGACCATCTCGTAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053053
VALIDATED
TADA1 MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053053.2-663s1c1
Sequence:CCGGGAAGAATAGTGTAGTAGCTTACTCGAGTAAGCTACTACACTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053053.3-256s21c1
Sequence:CCGGACAATACTGGGCTAACCTAAACTCGAGTTTAGGTTAGCCCAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-716s21c1
Sequence:CCGGGCTGTGGAGAATCACCTTAAACTCGAGTTTAAGGTGATTCTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-1903s21c1
Sequence:CCGGGGCAGTTTCTTCGGTTAATTACTCGAGTAATTAACCGAAGAAACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-1100s21c1
Sequence:CCGGACGAAACTCTGGCATCCAAATCTCGAGATTTGGATGCCAGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-775s21c1
Sequence:CCGGTCGGTTACGAGATGGTCATTTCTCGAGAAATGACCATCTCGTAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053053
VALIDATED
TADA1 MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053053.2-663s1c1
Sequence:CCGGGAAGAATAGTGTAGTAGCTTACTCGAGTAAGCTACTACACTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053053.3-256s21c1
Sequence:CCGGACAATACTGGGCTAACCTAAACTCGAGTTTAGGTTAGCCCAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-716s21c1
Sequence:CCGGGCTGTGGAGAATCACCTTAAACTCGAGTTTAAGGTGATTCTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-1903s21c1
Sequence:CCGGGGCAGTTTCTTCGGTTAATTACTCGAGTAATTAACCGAAGAAACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-1100s21c1
Sequence:CCGGACGAAACTCTGGCATCCAAATCTCGAGATTTGGATGCCAGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_053053.3-775s21c1
Sequence:CCGGTCGGTTACGAGATGGTCATTTCTCGAGAAATGACCATCTCGTAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030245
VALIDATED
TADA1 MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030245.2-1636s1c1
Sequence:CCGGGCTTTGATCCTTGAGTCCAATCTCGAGATTGGACTCAAGGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030245.2-169s1c1
Sequence:CCGGCGTGAAACAATACTGGGCCAACTCGAGTTGGCCCAGTATTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030245.2-1607s1c1
Sequence:CCGGGCAGGATTTAGCTCTGTGCTTCTCGAGAAGCACAGAGCTAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030245.2-550s1c1
Sequence:CCGGCCAACTTGAAGGGAGAATGATCTCGAGATCATTCTCCCTTCAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-991s21c1
Sequence:CCGGGTATGCCCTTAACATTGAAAGCTCGAGCTTTCAATGTTAAGGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-694s21c1
Sequence:CCGGCCGGGTACGAGATGGTCATTTCTCGAGAAATGACCATCTCGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030245.2-1636s21c1
Sequence:CCGGGCTTTGATCCTTGAGTCCAATCTCGAGATTGGACTCAAGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-641s21c1
Sequence:CCGGGAGAATCACCTCAAAGATATTCTCGAGAATATCTTTGAGGTGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-300s21c1
Sequence:CCGGTCCTCACACGTTGTCAGATTTCTCGAGAAATCTGACAACGTGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030245
VALIDATED
TADA1 MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030245.2-1636s1c1
Sequence:CCGGGCTTTGATCCTTGAGTCCAATCTCGAGATTGGACTCAAGGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030245.2-169s1c1
Sequence:CCGGCGTGAAACAATACTGGGCCAACTCGAGTTGGCCCAGTATTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030245.2-1607s1c1
Sequence:CCGGGCAGGATTTAGCTCTGTGCTTCTCGAGAAGCACAGAGCTAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030245.2-550s1c1
Sequence:CCGGCCAACTTGAAGGGAGAATGATCTCGAGATCATTCTCCCTTCAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-991s21c1
Sequence:CCGGGTATGCCCTTAACATTGAAAGCTCGAGCTTTCAATGTTAAGGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-694s21c1
Sequence:CCGGCCGGGTACGAGATGGTCATTTCTCGAGAAATGACCATCTCGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030245.2-1636s21c1
Sequence:CCGGGCTTTGATCCTTGAGTCCAATCTCGAGATTGGACTCAAGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-641s21c1
Sequence:CCGGGAGAATCACCTCAAAGATATTCTCGAGAATATCTTTGAGGTGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-300s21c1
Sequence:CCGGTCCTCACACGTTGTCAGATTTCTCGAGAAATCTGACAACGTGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030245
VALIDATED
TADA1 MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030245.2-1636s1c1
Sequence:CCGGGCTTTGATCCTTGAGTCCAATCTCGAGATTGGACTCAAGGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030245.2-169s1c1
Sequence:CCGGCGTGAAACAATACTGGGCCAACTCGAGTTGGCCCAGTATTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030245.2-1607s1c1
Sequence:CCGGGCAGGATTTAGCTCTGTGCTTCTCGAGAAGCACAGAGCTAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030245.2-550s1c1
Sequence:CCGGCCAACTTGAAGGGAGAATGATCTCGAGATCATTCTCCCTTCAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-991s21c1
Sequence:CCGGGTATGCCCTTAACATTGAAAGCTCGAGCTTTCAATGTTAAGGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-694s21c1
Sequence:CCGGCCGGGTACGAGATGGTCATTTCTCGAGAAATGACCATCTCGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030245.2-1636s21c1
Sequence:CCGGGCTTTGATCCTTGAGTCCAATCTCGAGATTGGACTCAAGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-641s21c1
Sequence:CCGGGAGAATCACCTCAAAGATATTCTCGAGAATATCTTTGAGGTGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030245.2-300s21c1
Sequence:CCGGTCCTCACACGTTGTCAGATTTCTCGAGAAATCTGACAACGTGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks