EMAIL THIS PAGE TO A FRIEND

TADA2A

transcriptional adaptor 2A

Synonyms: ADA2 ADA2A TADA2L hADA2
UniProtKB ID: O75478, A8MVD0, B3KMU9, Q9BVJ0, Q9UCW2, Q9UP49
Gene ID:
Human(6871) Summary: Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]
Mouse(217031) transcriptional adaptor 2A
Rat(360581) transcriptional adaptor 2A
Zebrafish(797303) transcriptional adaptor 2A
domestic cat(101087281) transcriptional adaptor 2A
Horse(100057641) transcriptional adaptor 2A
dog(480596) transcriptional adaptor 2A
chicken(417656) transcriptional adaptor 2A
naked mole-rat(101707362) transcriptional adaptor 2A
Domestic Rabbit(100349529) transcriptional adaptor 2A
domestic guinea pig(100734067) transcriptional adaptor 2A
cow(505401) transcriptional adaptor 2A
sheep(101111892) transcriptional adaptor 2A
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001488 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154211 MISSION® esiRNA esiRNA human TADA2L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001488 Rosetta Predictions human pricing
NM_133439 Rosetta Predictions human pricing
NM_001012141 Rosetta Predictions rat pricing
XM_001081090 Rosetta Predictions rat pricing
XM_573166 Rosetta Predictions rat pricing
NM_172562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085263 predicted 625
2 SASI_Hs01_00085264 predicted 660
3 SASI_Hs01_00085266 predicted 524
4 SASI_Hs01_00085267 predicted 436
5 SASI_Hs01_00085268 predicted 697
6 SASI_Hs01_00085269 predicted 457
7 SASI_Hs02_00331971 predicted 538
8 SASI_Hs01_00085270 predicted 684
9 SASI_Hs02_00331972 predicted 649
10 SASI_Hs02_00331973 predicted 635
11 SASI_Hs01_00085265 predicted 380
12 SASI_Hs01_00085271 predicted 540
13 SASI_Hs01_00085272 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064490 predicted 620
2 SASI_Hs01_00064491 predicted 662
3 SASI_Hs01_00064493 predicted 526
4 SASI_Hs01_00064494 predicted 429
5 SASI_Hs01_00064495 predicted 697
6 SASI_Hs01_00064496 predicted 459
7 SASI_Hs02_00363114 predicted 534
8 SASI_Hs01_00064497 predicted 687
9 SASI_Hs02_00363115 predicted 646
10 SASI_Hs02_00363116 predicted 635
11 SASI_Hs01_00064492 predicted 373
12 SASI_Hs01_00064498 predicted 545
13 SASI_Hs01_00064499 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035915 predicted 1053
2 SASI_Rn01_00035916 predicted 1321
3 SASI_Rn01_00035917 predicted 1179
4 SASI_Rn02_00200313 predicted 224
5 SASI_Rn01_00035918 predicted 1332
6 SASI_Rn01_00035919 predicted 1395
7 SASI_Rn01_00035920 predicted 831
8 SASI_Rn01_00035921 predicted 840
9 SASI_Rn01_00035922 predicted 700
10 SASI_Rn01_00035923 predicted 684
11 SASI_Rn01_00035924 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370564 predicted 487
2 SASI_Rn02_00370565 predicted 1063
3 SASI_Rn02_00370566 predicted 673
4 SASI_Rn02_00370567 predicted 885
5 SASI_Rn02_00370568 predicted 1185
6 SASI_Rn02_00370569 predicted 223
7 SASI_Rn02_00370570 predicted 699
8 SASI_Rn02_00370571 predicted 686
9 SASI_Rn02_00370572 predicted 959
10 SASI_Rn02_00370573 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143125 predicted 1062
2 SASI_Rn01_00143126 predicted 1323
3 SASI_Rn01_00143127 predicted 1181
4 SASI_Rn01_00143128 predicted 1341
5 SASI_Rn01_00143129 predicted 1409
6 SASI_Rn01_00143130 predicted 837
7 SASI_Rn01_00143131 predicted 844
8 SASI_Rn01_00143132 predicted 708
9 SASI_Rn01_00143133 predicted 696
10 SASI_Rn01_00143134 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095794 predicted 661
2 SASI_Mm01_00095795 predicted 403
3 SASI_Mm01_00095796 predicted 1348
4 SASI_Mm01_00095799 predicted 661
5 SASI_Mm01_00095800 predicted 641
6 SASI_Mm02_00344199 predicted 811
7 SASI_Mm02_00344200 predicted 1014
8 SASI_Mm02_00344201 predicted 1493
9 SASI_Mm02_00344202 predicted 908
10 SASI_Mm01_00095802 predicted 1364
11 SASI_Mm01_00095797 predicted 704
12 SASI_Mm01_00095798 predicted 552
13 SASI_Mm01_00095801 predicted 811
14 SASI_Mm01_00095803 predicted 1405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172562
VALIDATED
TADA2A MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 2A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172562.3-1638s21c1
Sequence:CCGGAGTGTGTGTTCGCCAAGTTATCTCGAGATAACTTGGCGAACACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172562.3-185s21c1
Sequence:CCGGCTCACGGAACCTTACATTAAACTCGAGTTTAATGTAAGGTTCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172562.3-811s21c1
Sequence:CCGGCCTTAGGAAGTTCCGATTAATCTCGAGATTAATCGGAACTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172562.3-856s21c1
Sequence:CCGGCCAAGACCTTTATGAAACAATCTCGAGATTGTTTCATAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172562.3-285s21c1
Sequence:CCGGGTGATCACACTTACGAAATAACTCGAGTTATTTCGTAAGTGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-260s1c1
Sequence:CCGGCGAGGATTTGAGTACAAGAAACTCGAGTTTCTTGTACTCAAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172562.1-859s1c1
Sequence:CCGGCCAAGACCTTTATGAAACAATCTCGAGATTGTTTCATAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172562.1-1424s1c1
Sequence:CCGGCGAGAAGGGTACATCACGAAACTCGAGTTTCGTGATGTACCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-413s1c1
Sequence:CCGGGCTAATCAAATGTGCACCAAACTCGAGTTTGGTGCACATTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-814s1c1
Sequence:CCGGCCTTAGGAAGTTCCGACTAATCTCGAGATTAGTCGGAACTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172562
VALIDATED
TADA2A MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 2A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172562.3-1638s21c1
Sequence:CCGGAGTGTGTGTTCGCCAAGTTATCTCGAGATAACTTGGCGAACACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172562.3-185s21c1
Sequence:CCGGCTCACGGAACCTTACATTAAACTCGAGTTTAATGTAAGGTTCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172562.3-811s21c1
Sequence:CCGGCCTTAGGAAGTTCCGATTAATCTCGAGATTAATCGGAACTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172562.3-856s21c1
Sequence:CCGGCCAAGACCTTTATGAAACAATCTCGAGATTGTTTCATAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172562.3-285s21c1
Sequence:CCGGGTGATCACACTTACGAAATAACTCGAGTTATTTCGTAAGTGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-260s1c1
Sequence:CCGGCGAGGATTTGAGTACAAGAAACTCGAGTTTCTTGTACTCAAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172562.1-859s1c1
Sequence:CCGGCCAAGACCTTTATGAAACAATCTCGAGATTGTTTCATAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172562.1-1424s1c1
Sequence:CCGGCGAGAAGGGTACATCACGAAACTCGAGTTTCGTGATGTACCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-413s1c1
Sequence:CCGGGCTAATCAAATGTGCACCAAACTCGAGTTTGGTGCACATTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-814s1c1
Sequence:CCGGCCTTAGGAAGTTCCGACTAATCTCGAGATTAGTCGGAACTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172562
VALIDATED
TADA2A MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 2A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172562.3-1638s21c1
Sequence:CCGGAGTGTGTGTTCGCCAAGTTATCTCGAGATAACTTGGCGAACACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172562.3-185s21c1
Sequence:CCGGCTCACGGAACCTTACATTAAACTCGAGTTTAATGTAAGGTTCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172562.3-811s21c1
Sequence:CCGGCCTTAGGAAGTTCCGATTAATCTCGAGATTAATCGGAACTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172562.3-856s21c1
Sequence:CCGGCCAAGACCTTTATGAAACAATCTCGAGATTGTTTCATAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172562.3-285s21c1
Sequence:CCGGGTGATCACACTTACGAAATAACTCGAGTTATTTCGTAAGTGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-260s1c1
Sequence:CCGGCGAGGATTTGAGTACAAGAAACTCGAGTTTCTTGTACTCAAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172562.1-859s1c1
Sequence:CCGGCCAAGACCTTTATGAAACAATCTCGAGATTGTTTCATAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172562.1-1424s1c1
Sequence:CCGGCGAGAAGGGTACATCACGAAACTCGAGTTTCGTGATGTACCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-413s1c1
Sequence:CCGGGCTAATCAAATGTGCACCAAACTCGAGTTTGGTGCACATTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172562.1-814s1c1
Sequence:CCGGCCTTAGGAAGTTCCGACTAATCTCGAGATTAGTCGGAACTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001488
VALIDATED
TADA2A MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 2A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-1705s21c1
Sequence:CCGGTCCAAGAGCTTGGGATCAGAACTCGAGTTCTGATCCCAAGCTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-1041s21c1
Sequence:CCGGTATAAGAGACCATGGATTAATCTCGAGATTAATCCATGGTCTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-947s21c1
Sequence:CCGGTTGAAGATGACTCGGACATTTCTCGAGAAATGTCCGAGTCATCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001488.3-435s21c1
Sequence:CCGGCTACCTCATGGAGCCTTATATCTCGAGATATAAGGCTCCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001488.3-705s21c1
Sequence:CCGGGCACTATATGAAGCATTTCATCTCGAGATGAAATGCTTCATATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001488.2-2005s1c1
Sequence:CCGGGCTGGTAGAAATGGAACTAAACTCGAGTTTAGTTCCATTTCTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001488.2-1321s1c1
Sequence:CCGGCGCACTATGCTCTCAGAAGTTCTCGAGAACTTCTGAGAGCATAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001488.2-601s1c1
Sequence:CCGGGCTCAAGAAGAAATGGCCCTTCTCGAGAAGGGCCATTTCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001488.2-708s1c1
Sequence:CCGGGCACTATATGAAGCATTTCATCTCGAGATGAAATGCTTCATATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001488
VALIDATED
TADA2A MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 2A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-1705s21c1
Sequence:CCGGTCCAAGAGCTTGGGATCAGAACTCGAGTTCTGATCCCAAGCTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-1041s21c1
Sequence:CCGGTATAAGAGACCATGGATTAATCTCGAGATTAATCCATGGTCTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-947s21c1
Sequence:CCGGTTGAAGATGACTCGGACATTTCTCGAGAAATGTCCGAGTCATCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001488.3-435s21c1
Sequence:CCGGCTACCTCATGGAGCCTTATATCTCGAGATATAAGGCTCCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001488.3-705s21c1
Sequence:CCGGGCACTATATGAAGCATTTCATCTCGAGATGAAATGCTTCATATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001488.2-2005s1c1
Sequence:CCGGGCTGGTAGAAATGGAACTAAACTCGAGTTTAGTTCCATTTCTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001488.2-1321s1c1
Sequence:CCGGCGCACTATGCTCTCAGAAGTTCTCGAGAACTTCTGAGAGCATAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001488.2-601s1c1
Sequence:CCGGGCTCAAGAAGAAATGGCCCTTCTCGAGAAGGGCCATTTCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001488.2-708s1c1
Sequence:CCGGGCACTATATGAAGCATTTCATCTCGAGATGAAATGCTTCATATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001488
VALIDATED
TADA2A MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 2A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-1705s21c1
Sequence:CCGGTCCAAGAGCTTGGGATCAGAACTCGAGTTCTGATCCCAAGCTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-1041s21c1
Sequence:CCGGTATAAGAGACCATGGATTAATCTCGAGATTAATCCATGGTCTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001488.3-947s21c1
Sequence:CCGGTTGAAGATGACTCGGACATTTCTCGAGAAATGTCCGAGTCATCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001488.3-435s21c1
Sequence:CCGGCTACCTCATGGAGCCTTATATCTCGAGATATAAGGCTCCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001488.3-705s21c1
Sequence:CCGGGCACTATATGAAGCATTTCATCTCGAGATGAAATGCTTCATATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001488.2-2005s1c1
Sequence:CCGGGCTGGTAGAAATGGAACTAAACTCGAGTTTAGTTCCATTTCTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001488.2-1321s1c1
Sequence:CCGGCGCACTATGCTCTCAGAAGTTCTCGAGAACTTCTGAGAGCATAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001488.2-601s1c1
Sequence:CCGGGCTCAAGAAGAAATGGCCCTTCTCGAGAAGGGCCATTTCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001488.2-708s1c1
Sequence:CCGGGCACTATATGAAGCATTTCATCTCGAGATGAAATGCTTCATATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks