EMAIL THIS PAGE TO A FRIEND

TADA2B

transcriptional adaptor 2B

Synonyms: ADA2(beta) ADA2B
UniProtKB ID: Q86TJ2, A0AUJ8, A4QMR7, B3KSN0, B3KU86, Q6MZG9
Gene ID:
Human(93624) Summary: TADA2B functions as a transcriptional adaptor protein that potentiates transcription through coordination of histone acetyltransferase (HAT) activity and by linking activation factors to basal transcriptional machinery (Barlev et al., 2003 [PubMed 12972612]
Mouse(231151) transcriptional adaptor 2B
Rat(289717) transcriptional adaptor 2B
cow(515581) transcriptional adaptor 2B
sheep(101118359) transcriptional adaptor 2B
domestic guinea pig(100734301) transcriptional adaptor 2B
naked mole-rat(101715559) transcriptional adaptor 2B
Zebrafish(554156) transcriptional adaptor 2 (ADA2 homolog, yeast)-beta
domestic cat(101090261) transcriptional adaptor 2B
dog(488783) transcriptional adaptor 2B
chicken(428796) transcriptional adaptor 2B
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_132031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152293 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026601 MISSION® esiRNA esiRNA human AC097382.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152293 Rosetta Predictions human pricing
XM_001063619 Rosetta Predictions rat pricing
XM_223519 Rosetta Predictions rat pricing
XM_132031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365852 predicted 1575
2 SASI_Hs02_00365853 predicted 1684
3 SASI_Hs02_00365854 predicted 1649
4 SASI_Hs02_00365855 predicted 1552
5 SASI_Hs02_00365856 predicted 1619
6 SASI_Hs02_00365857 predicted 806
7 SASI_Hs02_00365858 predicted 1781
8 SASI_Hs02_00365859 predicted 1565
9 SASI_Hs02_00365860 predicted 1562
10 SASI_Hs02_00365861 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307827 predicted 1038
2 SASI_Rn02_00307828 predicted 892
3 SASI_Rn02_00307829 predicted 991
4 SASI_Rn02_00307830 predicted 832
5 SASI_Rn02_00307831 predicted 1343
6 SASI_Rn02_00307832 predicted 565
7 SASI_Rn02_00307833 predicted 727
8 SASI_Rn02_00307834 predicted 1465
9 SASI_Rn02_00307835 predicted 1244
10 SASI_Rn02_00307836 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381467 predicted 1030
2 SASI_Rn02_00381468 predicted 888
3 SASI_Rn02_00381469 predicted 986
4 SASI_Rn02_00381470 predicted 835
5 SASI_Rn02_00381471 predicted 1348
6 SASI_Rn02_00381472 predicted 562
7 SASI_Rn02_00381473 predicted 727
8 SASI_Rn02_00381474 predicted 1466
9 SASI_Rn02_00381475 predicted 1248
10 SASI_Rn02_00381476 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219095 predicted 1288
2 SASI_Mm01_00219096 predicted 1299
3 SASI_Mm01_00219097 predicted 1334
4 SASI_Mm01_00219098 predicted 1341
5 SASI_Mm01_00219099 predicted 834
6 SASI_Mm01_00219100 predicted 894
7 SASI_Mm01_00219101 predicted 1344
8 SASI_Mm01_00219102 predicted 990
9 SASI_Mm01_00219103 predicted 566
10 SASI_Mm01_00219104 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132031
TADA2B MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1141s21c1
Sequence:CCGGATGGAGGAGTCGGCCGAATATCTCGAGATATTCGGCCGACTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1344s21c1
Sequence:CCGGTGTGACTGTGAAGACTATTATCTCGAGATAATAGTCTTCACAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-749s21c1
Sequence:CCGGATGATTATGAGATAGAGTATGCTCGAGCATACTCTATCTCATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_132031.6-2730s21c1
Sequence:CCGGGTGTTTGGGCTCGGAAGTAAACTCGAGTTTACTTCCGAGCCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1422s21c1
Sequence:CCGGTTATCTGGACAAGGTCCTAAACTCGAGTTTAGGACCTTGTCCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132031
TADA2B MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1141s21c1
Sequence:CCGGATGGAGGAGTCGGCCGAATATCTCGAGATATTCGGCCGACTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1344s21c1
Sequence:CCGGTGTGACTGTGAAGACTATTATCTCGAGATAATAGTCTTCACAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-749s21c1
Sequence:CCGGATGATTATGAGATAGAGTATGCTCGAGCATACTCTATCTCATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_132031.6-2730s21c1
Sequence:CCGGGTGTTTGGGCTCGGAAGTAAACTCGAGTTTACTTCCGAGCCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1422s21c1
Sequence:CCGGTTATCTGGACAAGGTCCTAAACTCGAGTTTAGGACCTTGTCCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132031
TADA2B MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1141s21c1
Sequence:CCGGATGGAGGAGTCGGCCGAATATCTCGAGATATTCGGCCGACTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1344s21c1
Sequence:CCGGTGTGACTGTGAAGACTATTATCTCGAGATAATAGTCTTCACAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-749s21c1
Sequence:CCGGATGATTATGAGATAGAGTATGCTCGAGCATACTCTATCTCATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_132031.6-2730s21c1
Sequence:CCGGGTGTTTGGGCTCGGAAGTAAACTCGAGTTTACTTCCGAGCCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132031.6-1422s21c1
Sequence:CCGGTTATCTGGACAAGGTCCTAAACTCGAGTTTAGGACCTTGTCCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152293
VALIDATED
TADA2B MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-1258s21c1
Sequence:CCGGCGTGACTGTGAAGACTATTATCTCGAGATAATAGTCTTCACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-813s21c1
Sequence:CCGGACATCGCCCGTGACTACAATCCTCGAGGATTGTAGTCACGGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-663s21c1
Sequence:CCGGATGATTACGAGATCGAGTATGCTCGAGCATACTCGATCTCGTAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152293.2-1337s21c1
Sequence:CCGGTACCTGGACAAAGTCCTAAAGCTCGAGCTTTAGGACTTTGTCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152293.2-3486s21c1
Sequence:CCGGGATTGCCAGACGTACTATATTCTCGAGAATATAGTACGTCTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152293
VALIDATED
TADA2B MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-1258s21c1
Sequence:CCGGCGTGACTGTGAAGACTATTATCTCGAGATAATAGTCTTCACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-813s21c1
Sequence:CCGGACATCGCCCGTGACTACAATCCTCGAGGATTGTAGTCACGGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-663s21c1
Sequence:CCGGATGATTACGAGATCGAGTATGCTCGAGCATACTCGATCTCGTAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152293.2-1337s21c1
Sequence:CCGGTACCTGGACAAAGTCCTAAAGCTCGAGCTTTAGGACTTTGTCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152293.2-3486s21c1
Sequence:CCGGGATTGCCAGACGTACTATATTCTCGAGAATATAGTACGTCTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152293
VALIDATED
TADA2B MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-1258s21c1
Sequence:CCGGCGTGACTGTGAAGACTATTATCTCGAGATAATAGTCTTCACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-813s21c1
Sequence:CCGGACATCGCCCGTGACTACAATCCTCGAGGATTGTAGTCACGGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_152293.2-663s21c1
Sequence:CCGGATGATTACGAGATCGAGTATGCTCGAGCATACTCGATCTCGTAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152293.2-1337s21c1
Sequence:CCGGTACCTGGACAAAGTCCTAAAGCTCGAGCTTTAGGACTTTGTCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152293.2-3486s21c1
Sequence:CCGGGATTGCCAGACGTACTATATTCTCGAGAATATAGTACGTCTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks