EMAIL THIS PAGE TO A FRIEND

TADA3

transcriptional adaptor 3

Synonyms: ADA3 NGG1 STAF54 TADA3L hADA3
UniProtKB ID: O75528, Q6FI83, Q9UFS2
Gene ID:
Human(10474) Summary: DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Mouse(101206) transcriptional adaptor 3
Rat(362414) transcriptional adaptor 3
chicken(416050) transcriptional adaptor 3
domestic cat(101084429) transcriptional adaptor 3
Horse(100052239) transcriptional adaptor 3
dog(476541) transcriptional adaptor 3
naked mole-rat(101698522) transcriptional adaptor 3
Domestic Rabbit(100347359) transcriptional adaptor 3
domestic guinea pig(100719194) transcriptional adaptor 3
cow(510184) transcriptional adaptor 3
sheep(101103513) transcriptional adaptor 3
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006354 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134091 MISSION® esiRNA esiRNA human TADA3L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006354 Rosetta Predictions human pricing
NM_133480 Rosetta Predictions human pricing
NM_001025734 Rosetta Predictions rat pricing
NM_133932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108003 predicted 926
2 SASI_Hs02_00341395 predicted 925
3 SASI_Hs01_00108006 predicted 1372
4 SASI_Hs01_00108008 predicted 1057
5 SASI_Hs02_00341396 predicted 1025
6 SASI_Hs01_00108009 predicted 954
7 SASI_Hs01_00108010 predicted 1024
8 SASI_Hs02_00341397 predicted 1374
9 SASI_Hs02_00341398 predicted 1053
10 SASI_Hs01_00108011 predicted 1245
11 SASI_Hs01_00108004 predicted 779
12 SASI_Hs01_00108005 predicted 796
13 SASI_Hs01_00108007 predicted 935
14 SASI_Hs01_00108012 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186837 predicted 923
2 SASI_Hs01_00186838 predicted 777
3 SASI_Hs01_00186839 predicted 799
4 SASI_Hs01_00186840 predicted 1378
5 SASI_Hs01_00186842 predicted 1055
6 SASI_Hs01_00186843 predicted 958
7 SASI_Hs01_00186844 predicted 1026
8 SASI_Hs01_00186845 predicted 1246
9 SASI_Hs01_00186846 predicted 924
10 SASI_Hs02_00363200 predicted 1009
11 SASI_Hs01_00186841 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082946 predicted 1672
2 SASI_Rn01_00082947 predicted 685
3 SASI_Rn01_00082948 predicted 694
4 SASI_Rn01_00082949 predicted 687
5 SASI_Rn01_00082950 predicted 969
6 SASI_Rn01_00082951 predicted 1209
7 SASI_Rn01_00082953 predicted 513
8 SASI_Rn01_00082954 predicted 844
9 SASI_Rn02_00203372 predicted 1465
10 SASI_Rn01_00082955 predicted 323
11 SASI_Rn01_00082952 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065341 predicted 1128
2 SASI_Mm01_00065342 predicted 426
3 SASI_Mm01_00065343 predicted 1594
4 SASI_Mm01_00065344 predicted 667
5 SASI_Mm01_00065345 predicted 237
6 SASI_Mm01_00065346 predicted 949
7 SASI_Mm01_00065347 predicted 1245
8 SASI_Mm01_00065348 predicted 607
9 SASI_Mm01_00065349 predicted 609
10 SASI_Mm01_00065350 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133932
VALIDATED
TADA3 MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-1586s21c1
Sequence:CCGGGCCAGAGGCTGCCTATCAAATCTCGAGATTTGATAGGCAGCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-761s21c1
Sequence:CCGGCCAGAAGATGAAGCTGAACATCTCGAGATGTTCAGCTTCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-605s21c1
Sequence:CCGGCCCAAGATCCAGGAATATGAACTCGAGTTCATATTCCTGGATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-324s21c1
Sequence:CCGGAGGACGATGGCATTGGCATTGCTCGAGCAATGCCAATGCCATCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-406s21c1
Sequence:CCGGGCGTGTACTGGAAGCTGAAACCTCGAGGTTTCAGCTTCCAGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-761s1c1
Sequence:CCGGCCAGAAGATGAAGCTGAACATCTCGAGATGTTCAGCTTCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-1382s1c1
Sequence:CCGGGCCGACAACGAAGTCATGGATCTCGAGATCCATGACTTCGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133932.1-1118s1c1
Sequence:CCGGCCGCGCAATCAGAACAAGCCTCTCGAGAGGCTTGTTCTGATTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133932.1-433s1c1
Sequence:CCGGCCTTACTGACTGGCAGGATAACTCGAGTTATCCTGCCAGTCAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-605s1c1
Sequence:CCGGCCCAAGATCCAGGAATATGAACTCGAGTTCATATTCCTGGATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133932
VALIDATED
TADA3 MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-1586s21c1
Sequence:CCGGGCCAGAGGCTGCCTATCAAATCTCGAGATTTGATAGGCAGCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-761s21c1
Sequence:CCGGCCAGAAGATGAAGCTGAACATCTCGAGATGTTCAGCTTCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-605s21c1
Sequence:CCGGCCCAAGATCCAGGAATATGAACTCGAGTTCATATTCCTGGATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-324s21c1
Sequence:CCGGAGGACGATGGCATTGGCATTGCTCGAGCAATGCCAATGCCATCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-406s21c1
Sequence:CCGGGCGTGTACTGGAAGCTGAAACCTCGAGGTTTCAGCTTCCAGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-761s1c1
Sequence:CCGGCCAGAAGATGAAGCTGAACATCTCGAGATGTTCAGCTTCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-1382s1c1
Sequence:CCGGGCCGACAACGAAGTCATGGATCTCGAGATCCATGACTTCGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133932.1-1118s1c1
Sequence:CCGGCCGCGCAATCAGAACAAGCCTCTCGAGAGGCTTGTTCTGATTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133932.1-433s1c1
Sequence:CCGGCCTTACTGACTGGCAGGATAACTCGAGTTATCCTGCCAGTCAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-605s1c1
Sequence:CCGGCCCAAGATCCAGGAATATGAACTCGAGTTCATATTCCTGGATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133932
VALIDATED
TADA3 MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-1586s21c1
Sequence:CCGGGCCAGAGGCTGCCTATCAAATCTCGAGATTTGATAGGCAGCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-761s21c1
Sequence:CCGGCCAGAAGATGAAGCTGAACATCTCGAGATGTTCAGCTTCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-605s21c1
Sequence:CCGGCCCAAGATCCAGGAATATGAACTCGAGTTCATATTCCTGGATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-324s21c1
Sequence:CCGGAGGACGATGGCATTGGCATTGCTCGAGCAATGCCAATGCCATCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133932.2-406s21c1
Sequence:CCGGGCGTGTACTGGAAGCTGAAACCTCGAGGTTTCAGCTTCCAGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-761s1c1
Sequence:CCGGCCAGAAGATGAAGCTGAACATCTCGAGATGTTCAGCTTCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-1382s1c1
Sequence:CCGGGCCGACAACGAAGTCATGGATCTCGAGATCCATGACTTCGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133932.1-1118s1c1
Sequence:CCGGCCGCGCAATCAGAACAAGCCTCTCGAGAGGCTTGTTCTGATTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133932.1-433s1c1
Sequence:CCGGCCTTACTGACTGGCAGGATAACTCGAGTTATCCTGCCAGTCAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133932.1-605s1c1
Sequence:CCGGCCCAAGATCCAGGAATATGAACTCGAGTTCATATTCCTGGATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006354
VALIDATED
TADA3 MISSION shRNA Bacterial Glycerol Stock
transcriptional adaptor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-927s21c1
Sequence:CCGGCAGCCCAAGATCCAGGAATATCTCGAGATATTCCTGGATCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-1464s21c1
Sequence:CCGGTTCAGTGTGCCGCATACTAAGCTCGAGCTTAGTATGCGGCACACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-849s21c1
Sequence:CCGGCCCAAGAAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006354.2-1948s21c1
Sequence:CCGGCAAATGGCGGCAGTCTCTAGACTCGAGTCTAGAGACTGCCGCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-1197s21c1
Sequence:CCGGGCTGTGGCTGACAAGAAGAAACTCGAGTTTCTTCTTGTCAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-1197s1c1
Sequence:CCGGGCTGTGGCTGACAAGAAGAAACTCGAGTTTCTTCTTGTCAGCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-849s1c1
Sequence:CCGGCCCAAGAAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006354.2-582s1c1
Sequence:CCGGCACGACTTCAAGTCTGTGGATCTCGAGATCCACAGACTTGAAGTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-1374s1c1
Sequence:CCGGCCTATGGAGGATTCTCCTATTCTCGAGAATAGGAGAATCCTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-927s1c1
Sequence:CCGGCAGCCCAAGATCCAGGAATATCTCGAGATATTCCTGGATCTTGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006354
VALIDATED
TADA3 MISSION shRNA shRNA Plasmid DNA
transcriptional adaptor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-927s21c1
Sequence:CCGGCAGCCCAAGATCCAGGAATATCTCGAGATATTCCTGGATCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-1464s21c1
Sequence:CCGGTTCAGTGTGCCGCATACTAAGCTCGAGCTTAGTATGCGGCACACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-849s21c1
Sequence:CCGGCCCAAGAAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006354.2-1948s21c1
Sequence:CCGGCAAATGGCGGCAGTCTCTAGACTCGAGTCTAGAGACTGCCGCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-1197s21c1
Sequence:CCGGGCTGTGGCTGACAAGAAGAAACTCGAGTTTCTTCTTGTCAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-1197s1c1
Sequence:CCGGGCTGTGGCTGACAAGAAGAAACTCGAGTTTCTTCTTGTCAGCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-849s1c1
Sequence:CCGGCCCAAGAAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006354.2-582s1c1
Sequence:CCGGCACGACTTCAAGTCTGTGGATCTCGAGATCCACAGACTTGAAGTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-1374s1c1
Sequence:CCGGCCTATGGAGGATTCTCCTATTCTCGAGAATAGGAGAATCCTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-927s1c1
Sequence:CCGGCAGCCCAAGATCCAGGAATATCTCGAGATATTCCTGGATCTTGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006354
VALIDATED
TADA3 MISSION shRNA Lentiviral Transduction Particles
transcriptional adaptor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-927s21c1
Sequence:CCGGCAGCCCAAGATCCAGGAATATCTCGAGATATTCCTGGATCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-1464s21c1
Sequence:CCGGTTCAGTGTGCCGCATACTAAGCTCGAGCTTAGTATGCGGCACACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-849s21c1
Sequence:CCGGCCCAAGAAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006354.2-1948s21c1
Sequence:CCGGCAAATGGCGGCAGTCTCTAGACTCGAGTCTAGAGACTGCCGCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006354.2-1197s21c1
Sequence:CCGGGCTGTGGCTGACAAGAAGAAACTCGAGTTTCTTCTTGTCAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-1197s1c1
Sequence:CCGGGCTGTGGCTGACAAGAAGAAACTCGAGTTTCTTCTTGTCAGCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-849s1c1
Sequence:CCGGCCCAAGAAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006354.2-582s1c1
Sequence:CCGGCACGACTTCAAGTCTGTGGATCTCGAGATCCACAGACTTGAAGTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-1374s1c1
Sequence:CCGGCCTATGGAGGATTCTCCTATTCTCGAGAATAGGAGAATCCTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006354.2-927s1c1
Sequence:CCGGCAGCCCAAGATCCAGGAATATCTCGAGATATTCCTGGATCTTGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks