EMAIL THIS PAGE TO A FRIEND

TAF10

TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa

Synonyms: TAF2A TAF2H TAFII30
UniProtKB ID: Q12962, O00703, Q13175, Q6FH13
Gene ID:
Human(6881) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the small subunits of TFIID that is associated with a subset of TFIID complexes. Studies with human and mammalian cells have shown that this subunit is required for transcriptional activation by the estrogen receptor, for progression through the cell cycle, and may also be required for certain cellular differentiation programs. [provided by RefSeq, Jul 2008]
Mouse(24075) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(293345) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor
cow(514443) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
sheep(101110174) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
naked mole-rat(101705860) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
domestic guinea pig(100734225) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
fruit fly(33469) TBP-associated factor 10
domestic cat(101093046) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
dog(485336) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
Zebrafish(556710) TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Gene Class: Apoptosis
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004148 Anti-TAF10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV31426 Anti-TAF10 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, canine, zebrafish, rat, rabbit, horse, bovine
western blot pricing
SAB2104295 Anti-TAF10 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, rabbit, bovine, zebrafish, canine, human, rat
western blot pricing
SAB1411324 Anti-TAF10 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015081 MISSION® esiRNA esiRNA targeting human TAF10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006284 Rosetta Predictions human pricing
NM_001134735 Rosetta Predictions rat pricing
XM_215028 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035456 predicted 355
2 SASI_Hs01_00035458 predicted 468
3 SASI_Hs01_00035459 predicted 465
4 SASI_Hs01_00035460 predicted 506
5 SASI_Hs01_00035461 predicted 452
6 SASI_Hs01_00035462 predicted 328
7 SASI_Hs02_00341269 predicted 445
8 SASI_Hs01_00035463 predicted 490
9 SASI_Hs01_00035464 predicted 434
10 SASI_Hs02_00341270 predicted 405
11 SASI_Hs01_00035457 predicted 369
12 SASI_Hs01_00035465 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258244 predicted 462
2 SASI_Rn02_00258245 predicted 449
3 SASI_Rn02_00258246 predicted 399
4 SASI_Rn02_00258247 predicted 481
5 SASI_Rn02_00258248 predicted 453
6 SASI_Rn02_00258249 predicted 419
7 SASI_Rn02_00258250 predicted 337
8 SASI_Rn02_00258251 predicted 318
9 SASI_Rn02_00258252 predicted 373
10 SASI_Rn02_00258253 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173964 predicted 320
2 SASI_Rn01_00173965 predicted 431
3 SASI_Rn01_00173966 predicted 388
4 SASI_Rn01_00173967 predicted 299
5 SASI_Rn01_00173968 predicted 418
6 SASI_Rn01_00173969 predicted 309
7 SASI_Rn01_00173970 predicted 290
8 SASI_Rn01_00173971 predicted 364
9 SASI_Rn01_00173972 predicted 346
10 SASI_Rn01_00173973 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006284
VALIDATED
TAF10 MISSION shRNA Bacterial Glycerol Stock
TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-469s21c1
Sequence:CCGGCCCACGCATAATTCGGCTCATCTCGAGATGAGCCGAATTATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-595s21c1
Sequence:CCGGCCGCAAGTACACTCTAACCATCTCGAGATGGTTAGAGTGTACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-418s21c1
Sequence:CCGGAGATGCAGTGACTGGTTACTACTCGAGTAGTAACCAGTCACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-502s21c1
Sequence:CCGGCCAGAAATTCATCTCAGATATCTCGAGATATCTGAGATGAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-390s21c1
Sequence:CCGGAGCTGGAAGATTACACGCCTACTCGAGTAGGCGTGTAATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-595s1c1
Sequence:CCGGCCGCAAGTACACTCTAACCATCTCGAGATGGTTAGAGTGTACTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-502s1c1
Sequence:CCGGCCAGAAATTCATCTCAGATATCTCGAGATATCTGAGATGAATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-469s1c1
Sequence:CCGGCCCACGCATAATTCGGCTCATCTCGAGATGAGCCGAATTATGCGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-390s1c1
Sequence:CCGGAGCTGGAAGATTACACGCCTACTCGAGTAGGCGTGTAATCTTCCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-418s1c1
Sequence:CCGGAGATGCAGTGACTGGTTACTACTCGAGTAGTAACCAGTCACTGCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006284
VALIDATED
TAF10 MISSION shRNA shRNA Plasmid DNA
TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-469s21c1
Sequence:CCGGCCCACGCATAATTCGGCTCATCTCGAGATGAGCCGAATTATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-595s21c1
Sequence:CCGGCCGCAAGTACACTCTAACCATCTCGAGATGGTTAGAGTGTACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-418s21c1
Sequence:CCGGAGATGCAGTGACTGGTTACTACTCGAGTAGTAACCAGTCACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-502s21c1
Sequence:CCGGCCAGAAATTCATCTCAGATATCTCGAGATATCTGAGATGAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-390s21c1
Sequence:CCGGAGCTGGAAGATTACACGCCTACTCGAGTAGGCGTGTAATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-595s1c1
Sequence:CCGGCCGCAAGTACACTCTAACCATCTCGAGATGGTTAGAGTGTACTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-502s1c1
Sequence:CCGGCCAGAAATTCATCTCAGATATCTCGAGATATCTGAGATGAATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-469s1c1
Sequence:CCGGCCCACGCATAATTCGGCTCATCTCGAGATGAGCCGAATTATGCGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-390s1c1
Sequence:CCGGAGCTGGAAGATTACACGCCTACTCGAGTAGGCGTGTAATCTTCCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-418s1c1
Sequence:CCGGAGATGCAGTGACTGGTTACTACTCGAGTAGTAACCAGTCACTGCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006284
VALIDATED
TAF10 MISSION shRNA Lentiviral Transduction Particles
TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-469s21c1
Sequence:CCGGCCCACGCATAATTCGGCTCATCTCGAGATGAGCCGAATTATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-595s21c1
Sequence:CCGGCCGCAAGTACACTCTAACCATCTCGAGATGGTTAGAGTGTACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-418s21c1
Sequence:CCGGAGATGCAGTGACTGGTTACTACTCGAGTAGTAACCAGTCACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-502s21c1
Sequence:CCGGCCAGAAATTCATCTCAGATATCTCGAGATATCTGAGATGAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006284.2-390s21c1
Sequence:CCGGAGCTGGAAGATTACACGCCTACTCGAGTAGGCGTGTAATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-595s1c1
Sequence:CCGGCCGCAAGTACACTCTAACCATCTCGAGATGGTTAGAGTGTACTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-502s1c1
Sequence:CCGGCCAGAAATTCATCTCAGATATCTCGAGATATCTGAGATGAATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-469s1c1
Sequence:CCGGCCCACGCATAATTCGGCTCATCTCGAGATGAGCCGAATTATGCGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-390s1c1
Sequence:CCGGAGCTGGAAGATTACACGCCTACTCGAGTAGGCGTGTAATCTTCCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006284.2-418s1c1
Sequence:CCGGAGATGCAGTGACTGGTTACTACTCGAGTAGTAACCAGTCACTGCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020024
TAF10 MISSION shRNA Bacterial Glycerol Stock
TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-513s1c1
Sequence:CCGGGATATTGCCAATGATGCCCTACTCGAGTAGGGCATCATTGGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-368s1c1
Sequence:CCGGAGTGGACTTCTTGATGCAGTTCTCGAGAACTGCATCAAGAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-635s1c1
Sequence:CCGGCGAGTATGGCATCAATGTGAACTCGAGTTCACATTGATGCCATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-630s1c1
Sequence:CCGGCTCAGCGAGTATGGCATCAATCTCGAGATTGATGCCATACTCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-359s1c1
Sequence:CCGGCACACCTCTAGTGGACTTCTTCTCGAGAAGAAGTCCACTAGAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-590s1c1
Sequence:CCGGTCGCAAGTACACCCTAACCATCTCGAGATGGTTAGGGTGTACTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-377s1c1
Sequence:CCGGCTTGATGCAGTTGGAGGATTACTCGAGTAATCCTCCAACTGCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-495s1c1
Sequence:CCGGGCCCAGAAATTCATCTCAGATCTCGAGATCTGAGATGAATTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-484s1c1
Sequence:CCGGTCTCACTAGCTGCCCAGAAATCTCGAGATTTCTGGGCAGCTAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-578s1c1
Sequence:CCGGCAAGAGCAAGGATCGCAAGTACTCGAGTACTTGCGATCCTTGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020024
TAF10 MISSION shRNA shRNA Plasmid DNA
TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-513s1c1
Sequence:CCGGGATATTGCCAATGATGCCCTACTCGAGTAGGGCATCATTGGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-368s1c1
Sequence:CCGGAGTGGACTTCTTGATGCAGTTCTCGAGAACTGCATCAAGAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-635s1c1
Sequence:CCGGCGAGTATGGCATCAATGTGAACTCGAGTTCACATTGATGCCATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-630s1c1
Sequence:CCGGCTCAGCGAGTATGGCATCAATCTCGAGATTGATGCCATACTCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-359s1c1
Sequence:CCGGCACACCTCTAGTGGACTTCTTCTCGAGAAGAAGTCCACTAGAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-590s1c1
Sequence:CCGGTCGCAAGTACACCCTAACCATCTCGAGATGGTTAGGGTGTACTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-377s1c1
Sequence:CCGGCTTGATGCAGTTGGAGGATTACTCGAGTAATCCTCCAACTGCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-495s1c1
Sequence:CCGGGCCCAGAAATTCATCTCAGATCTCGAGATCTGAGATGAATTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-484s1c1
Sequence:CCGGTCTCACTAGCTGCCCAGAAATCTCGAGATTTCTGGGCAGCTAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-578s1c1
Sequence:CCGGCAAGAGCAAGGATCGCAAGTACTCGAGTACTTGCGATCCTTGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020024
TAF10 MISSION shRNA Lentiviral Transduction Particles
TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-513s1c1
Sequence:CCGGGATATTGCCAATGATGCCCTACTCGAGTAGGGCATCATTGGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-368s1c1
Sequence:CCGGAGTGGACTTCTTGATGCAGTTCTCGAGAACTGCATCAAGAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-635s1c1
Sequence:CCGGCGAGTATGGCATCAATGTGAACTCGAGTTCACATTGATGCCATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-630s1c1
Sequence:CCGGCTCAGCGAGTATGGCATCAATCTCGAGATTGATGCCATACTCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-359s1c1
Sequence:CCGGCACACCTCTAGTGGACTTCTTCTCGAGAAGAAGTCCACTAGAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-590s1c1
Sequence:CCGGTCGCAAGTACACCCTAACCATCTCGAGATGGTTAGGGTGTACTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-377s1c1
Sequence:CCGGCTTGATGCAGTTGGAGGATTACTCGAGTAATCCTCCAACTGCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.1-495s1c1
Sequence:CCGGGCCCAGAAATTCATCTCAGATCTCGAGATCTGAGATGAATTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-484s1c1
Sequence:CCGGTCTCACTAGCTGCCCAGAAATCTCGAGATTTCTGGGCAGCTAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020024.3-578s1c1
Sequence:CCGGCAAGAGCAAGGATCGCAAGTACTCGAGTACTTGCGATCCTTGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks