EMAIL THIS PAGE TO A FRIEND

TAF11

TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa

Synonyms: MGC:15243 TAF2I TAFII28
UniProtKB ID: Q15544, B2R8R3, B4DY18, Q9UHS0
Gene ID:
Human(6882) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit of TFIID that is present in all TFIID complexes and interacts with TBP. This subunit also interacts with another small subunit, TAF13, to form a heterodimer with a structure similar to the histone core structure. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(68776) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(309638) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor
fruit fly(34293) TBP-associated factor 11
domestic cat(101096982) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
dog(474881) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
chicken(419899) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Zebrafish(436821) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Thale Cress(827775) TBP-associated factor 11
domestic guinea pig(100726219) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
naked mole-rat(101726744) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
cow(507047) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
sheep(101120963) TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301594 Anti-TAF11 affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB1412318 ANTI-TAF11 antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412319 ANTI-TAF11 antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412320 ANTI-TAF11 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV32136 Anti-TAF11 antibody produced in rabbit affinity isolated antibody horse, guinea pig, bovine, human, rabbit
western blot pricing
SAB1411325 Anti-TAF11 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA029326 Anti-TAF11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA049127 Anti-TAF11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0006882M7 Monoclonal Anti-TAF11 antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404439 Monoclonal Anti-TAF11, (C-terminal) antibody produced in mouse clone 3D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005643 Rosetta Predictions human pricing
NM_001008350 Rosetta Predictions rat pricing
NM_026836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237905 predicted 783
2 SASI_Hs01_00237906 predicted 653
3 SASI_Hs01_00237907 predicted 732
4 SASI_Hs01_00237909 predicted 617
5 SASI_Hs01_00237911 predicted 816
6 SASI_Hs01_00237912 predicted 729
7 SASI_Hs01_00237913 predicted 747
8 SASI_Hs01_00237914 predicted 726
9 SASI_Hs02_00339991 predicted 669
10 SASI_Hs02_00339992 predicted 787
11 SASI_Hs01_00237908 predicted 814
12 SASI_Hs01_00237910 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087031 predicted 961
2 SASI_Rn01_00087033 predicted 910
3 SASI_Rn01_00087034 predicted 526
4 SASI_Rn01_00087035 predicted 250
5 SASI_Rn01_00087036 predicted 520
6 SASI_Rn02_00199102 predicted 858
7 SASI_Rn01_00087037 predicted 839
8 SASI_Rn01_00087038 predicted 253
9 SASI_Rn01_00087039 predicted 501
10 SASI_Rn01_00087040 predicted 270
11 SASI_Rn01_00087032 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331016 predicted 226
2 SASI_Mm01_00024358 predicted 960
3 SASI_Mm01_00024359 predicted 676
4 SASI_Mm01_00024360 predicted 480
5 SASI_Mm01_00024361 predicted 229
6 SASI_Mm01_00024362 predicted 501
7 SASI_Mm01_00024363 predicted 956
8 SASI_Mm01_00024364 predicted 227
9 SASI_Mm01_00024366 predicted 696
10 SASI_Mm01_00024367 predicted 873
11 SASI_Mm01_00024365 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005643
VALIDATED
TAF11 MISSION shRNA Bacterial Glycerol Stock
TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-739s1c1
Sequence:CCGGCCTATGTTACTGACGGAAGAACTCGAGTTCTTCCGTCAGTAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-682s1c1
Sequence:CCGGGATCCCTAACTCGAAGCACAACTCGAGTTGTGCTTCGAGTTAGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005643.2-436s1c1
Sequence:CCGGGCTGAACCGTTATGAAATGTACTCGAGTACATTTCATAACGGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-215s1c1
Sequence:CCGGGCAGATGTGGACTTGAAAGAACTCGAGTTCTTTCAAGTCCACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005643.2-623s1c1
Sequence:CCGGCCACCACTACAACCCAAACATCTCGAGATGTTTGGGTTGTAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-215s21c1
Sequence:CCGGGCAGATGTGGACTTGAAAGAACTCGAGTTCTTTCAAGTCCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005643.2-739s21c1
Sequence:CCGGCCTATGTTACTGACGGAAGAACTCGAGTTCTTCCGTCAGTAACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-436s21c1
Sequence:CCGGGCTGAACCGTTATGAAATGTACTCGAGTACATTTCATAACGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-623s21c1
Sequence:CCGGCCACCACTACAACCCAAACATCTCGAGATGTTTGGGTTGTAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005643
VALIDATED
TAF11 MISSION shRNA shRNA Plasmid DNA
TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-739s1c1
Sequence:CCGGCCTATGTTACTGACGGAAGAACTCGAGTTCTTCCGTCAGTAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-682s1c1
Sequence:CCGGGATCCCTAACTCGAAGCACAACTCGAGTTGTGCTTCGAGTTAGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005643.2-436s1c1
Sequence:CCGGGCTGAACCGTTATGAAATGTACTCGAGTACATTTCATAACGGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-215s1c1
Sequence:CCGGGCAGATGTGGACTTGAAAGAACTCGAGTTCTTTCAAGTCCACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005643.2-623s1c1
Sequence:CCGGCCACCACTACAACCCAAACATCTCGAGATGTTTGGGTTGTAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-215s21c1
Sequence:CCGGGCAGATGTGGACTTGAAAGAACTCGAGTTCTTTCAAGTCCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005643.2-739s21c1
Sequence:CCGGCCTATGTTACTGACGGAAGAACTCGAGTTCTTCCGTCAGTAACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-436s21c1
Sequence:CCGGGCTGAACCGTTATGAAATGTACTCGAGTACATTTCATAACGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-623s21c1
Sequence:CCGGCCACCACTACAACCCAAACATCTCGAGATGTTTGGGTTGTAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005643
VALIDATED
TAF11 MISSION shRNA Lentiviral Transduction Particles
TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-739s1c1
Sequence:CCGGCCTATGTTACTGACGGAAGAACTCGAGTTCTTCCGTCAGTAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-682s1c1
Sequence:CCGGGATCCCTAACTCGAAGCACAACTCGAGTTGTGCTTCGAGTTAGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005643.2-436s1c1
Sequence:CCGGGCTGAACCGTTATGAAATGTACTCGAGTACATTTCATAACGGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005643.2-215s1c1
Sequence:CCGGGCAGATGTGGACTTGAAAGAACTCGAGTTCTTTCAAGTCCACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005643.2-623s1c1
Sequence:CCGGCCACCACTACAACCCAAACATCTCGAGATGTTTGGGTTGTAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-215s21c1
Sequence:CCGGGCAGATGTGGACTTGAAAGAACTCGAGTTCTTTCAAGTCCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005643.2-739s21c1
Sequence:CCGGCCTATGTTACTGACGGAAGAACTCGAGTTCTTCCGTCAGTAACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-436s21c1
Sequence:CCGGGCTGAACCGTTATGAAATGTACTCGAGTACATTTCATAACGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005643.2-623s21c1
Sequence:CCGGCCACCACTACAACCCAAACATCTCGAGATGTTTGGGTTGTAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026836
VALIDATED
TAF11 MISSION shRNA Bacterial Glycerol Stock
TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026836.1-912s1c1
Sequence:CCGGCCTTTAGTATCTTCTGGAGAACTCGAGTTCTCCAGAAGATACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-666s1c1
Sequence:CCGGGCACAAGAAGATCACCTTCTTCTCGAGAAGAAGGTGATCTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-402s1c1
Sequence:CCGGGCAGCTGAACCGTTATGAAATCTCGAGATTTCATAACGGTTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-233s1c1
Sequence:CCGGGTCAGGATGTCTCAGATGTAACTCGAGTTACATCTGAGACATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-309s1c1
Sequence:CCGGACTAGACATTAAGGACAAGAACTCGAGTTCTTGTCCTTAATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-356s21c1
Sequence:CCGGTGAGATTCAGAAGATGCAAATCTCGAGATTTGCATCTTCTGAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-490s21c1
Sequence:CCGGTGTCTCAGAATGTTGTGATTGCTCGAGCAATCACAACATTCTGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-871s21c1
Sequence:CCGGTACTGACTCTTGGCTAGTTTGCTCGAGCAAACTAGCCAAGAGTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-334s21c1
Sequence:CCGGAGAAGCAGAAGGTGGACGAAGCTCGAGCTTCGTCCACCTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026836.2-181s21c1
Sequence:CCGGATGGAGACGCGGACTTGAAAGCTCGAGCTTTCAAGTCCGCGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026836
VALIDATED
TAF11 MISSION shRNA shRNA Plasmid DNA
TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026836.1-912s1c1
Sequence:CCGGCCTTTAGTATCTTCTGGAGAACTCGAGTTCTCCAGAAGATACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-666s1c1
Sequence:CCGGGCACAAGAAGATCACCTTCTTCTCGAGAAGAAGGTGATCTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-402s1c1
Sequence:CCGGGCAGCTGAACCGTTATGAAATCTCGAGATTTCATAACGGTTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-233s1c1
Sequence:CCGGGTCAGGATGTCTCAGATGTAACTCGAGTTACATCTGAGACATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-309s1c1
Sequence:CCGGACTAGACATTAAGGACAAGAACTCGAGTTCTTGTCCTTAATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-356s21c1
Sequence:CCGGTGAGATTCAGAAGATGCAAATCTCGAGATTTGCATCTTCTGAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-490s21c1
Sequence:CCGGTGTCTCAGAATGTTGTGATTGCTCGAGCAATCACAACATTCTGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-871s21c1
Sequence:CCGGTACTGACTCTTGGCTAGTTTGCTCGAGCAAACTAGCCAAGAGTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-334s21c1
Sequence:CCGGAGAAGCAGAAGGTGGACGAAGCTCGAGCTTCGTCCACCTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026836.2-181s21c1
Sequence:CCGGATGGAGACGCGGACTTGAAAGCTCGAGCTTTCAAGTCCGCGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026836
VALIDATED
TAF11 MISSION shRNA Lentiviral Transduction Particles
TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026836.1-912s1c1
Sequence:CCGGCCTTTAGTATCTTCTGGAGAACTCGAGTTCTCCAGAAGATACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-666s1c1
Sequence:CCGGGCACAAGAAGATCACCTTCTTCTCGAGAAGAAGGTGATCTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-402s1c1
Sequence:CCGGGCAGCTGAACCGTTATGAAATCTCGAGATTTCATAACGGTTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-233s1c1
Sequence:CCGGGTCAGGATGTCTCAGATGTAACTCGAGTTACATCTGAGACATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026836.1-309s1c1
Sequence:CCGGACTAGACATTAAGGACAAGAACTCGAGTTCTTGTCCTTAATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-356s21c1
Sequence:CCGGTGAGATTCAGAAGATGCAAATCTCGAGATTTGCATCTTCTGAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-490s21c1
Sequence:CCGGTGTCTCAGAATGTTGTGATTGCTCGAGCAATCACAACATTCTGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-871s21c1
Sequence:CCGGTACTGACTCTTGGCTAGTTTGCTCGAGCAAACTAGCCAAGAGTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026836.2-334s21c1
Sequence:CCGGAGAAGCAGAAGGTGGACGAAGCTCGAGCTTCGTCCACCTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026836.2-181s21c1
Sequence:CCGGATGGAGACGCGGACTTGAAAGCTCGAGCTTTCAAGTCCGCGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks