EMAIL THIS PAGE TO A FRIEND

TAF12

TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa

Synonyms: TAF2J TAFII20
UniProtKB ID: Q16514, D3DPM5, Q15775, Q5T077
Gene ID:
Human(6883) Summary: Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(66464) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(682902) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor
fruit fly(41406) TBP-associated factor 12
Zebrafish(386637) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor
domestic cat(101087761) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
dog(609994) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
chicken(419585) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Thale Cress(820168) TBP-associated factor 12
cow(614227) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
sheep(101101958) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
naked mole-rat(101719733) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
domestic guinea pig(100717935) TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005644 Rosetta Predictions human pricing
NM_001115036 Rosetta Predictions rat pricing
NM_025579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339993 predicted 357
2 SASI_Hs01_00237386 predicted 412
3 SASI_Hs02_00339994 predicted 348
4 SASI_Hs02_00339995 predicted 264
5 SASI_Hs01_00237387 predicted 372
6 SASI_Hs01_00237388 predicted 242
7 SASI_Hs01_00237389 predicted 409
8 SASI_Hs02_00339996 predicted 337
9 SASI_Hs01_00237390 predicted 240
10 SASI_Hs02_00339997 predicted 366
11 SASI_Hs01_00237385 predicted 330
12 SASI_Hs01_00237391 predicted 334
13 SASI_Hs01_00237392 predicted 448
14 SASI_Hs01_00237393 predicted 453
15 SASI_Hs01_00237394 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252533 predicted 340
2 SASI_Rn02_00252534 predicted 1057
3 SASI_Rn02_00252535 predicted 1021
4 SASI_Rn02_00252536 predicted 323
5 SASI_Rn02_00252537 predicted 338
6 SASI_Rn02_00252538 predicted 380
7 SASI_Rn02_00252539 predicted 1018
8 SASI_Rn02_00252540 predicted 1052
9 SASI_Rn02_00252541 predicted 349
10 SASI_Rn02_00252542 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138840 predicted 1018
2 SASI_Mm01_00138841 predicted 233
3 SASI_Mm01_00138842 predicted 352
4 SASI_Mm01_00138843 predicted 939
5 SASI_Mm01_00138844 predicted 334
6 SASI_Mm01_00138845 predicted 948
7 SASI_Mm01_00138846 predicted 365
8 SASI_Mm01_00138847 predicted 1050
9 SASI_Mm01_00138848 predicted 957
10 SASI_Mm01_00138849 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005644
VALIDATED
TAF12 MISSION shRNA Bacterial Glycerol Stock
TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-399s21c1
Sequence:CCGGCCTAATGAGCAGTTGGATGAACTCGAGTTCATCCAACTGCTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-281s21c1
Sequence:CCGGCAATAGTACTGCAGTGGTAAACTCGAGTTTACCACTGCAGTACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-220s21c1
Sequence:CCGGTCTCCAATTTCTCATCCATAACTCGAGTTATGGATGAGAAATTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005644.3-687s21c1
Sequence:CCGGGGGAATGGACAGCAATGTATTCTCGAGAATACATTGCTGTCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-613s21c1
Sequence:CCGGGCACCACAGAAGCTCACAAACCTCGAGGTTTGTGAGCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005644.2-858s1c1
Sequence:CCGGGCCATCTCAAAGAGGAGCAATCTCGAGATTGCTCCTCTTTGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005644.2-380s1c1
Sequence:CCGGCCTAATGAGCAGTTGGATGAACTCGAGTTCATCCAACTGCTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-202s1c1
Sequence:CCGGCTCCAATTTCTCATCCATAAACTCGAGTTTATGGATGAGAAATTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-260s1c1
Sequence:CCGGGCCAATAGTACTGCAGTGGTACTCGAGTACCACTGCAGTACTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-605s1c1
Sequence:CCGGGCTCACAAACAGAGAATGGCACTCGAGTGCCATTCTCTGTTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005644
VALIDATED
TAF12 MISSION shRNA shRNA Plasmid DNA
TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-399s21c1
Sequence:CCGGCCTAATGAGCAGTTGGATGAACTCGAGTTCATCCAACTGCTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-281s21c1
Sequence:CCGGCAATAGTACTGCAGTGGTAAACTCGAGTTTACCACTGCAGTACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-220s21c1
Sequence:CCGGTCTCCAATTTCTCATCCATAACTCGAGTTATGGATGAGAAATTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005644.3-687s21c1
Sequence:CCGGGGGAATGGACAGCAATGTATTCTCGAGAATACATTGCTGTCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-613s21c1
Sequence:CCGGGCACCACAGAAGCTCACAAACCTCGAGGTTTGTGAGCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005644.2-858s1c1
Sequence:CCGGGCCATCTCAAAGAGGAGCAATCTCGAGATTGCTCCTCTTTGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005644.2-380s1c1
Sequence:CCGGCCTAATGAGCAGTTGGATGAACTCGAGTTCATCCAACTGCTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-202s1c1
Sequence:CCGGCTCCAATTTCTCATCCATAAACTCGAGTTTATGGATGAGAAATTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-260s1c1
Sequence:CCGGGCCAATAGTACTGCAGTGGTACTCGAGTACCACTGCAGTACTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-605s1c1
Sequence:CCGGGCTCACAAACAGAGAATGGCACTCGAGTGCCATTCTCTGTTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005644
VALIDATED
TAF12 MISSION shRNA Lentiviral Transduction Particles
TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-399s21c1
Sequence:CCGGCCTAATGAGCAGTTGGATGAACTCGAGTTCATCCAACTGCTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-281s21c1
Sequence:CCGGCAATAGTACTGCAGTGGTAAACTCGAGTTTACCACTGCAGTACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-220s21c1
Sequence:CCGGTCTCCAATTTCTCATCCATAACTCGAGTTATGGATGAGAAATTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005644.3-687s21c1
Sequence:CCGGGGGAATGGACAGCAATGTATTCTCGAGAATACATTGCTGTCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005644.3-613s21c1
Sequence:CCGGGCACCACAGAAGCTCACAAACCTCGAGGTTTGTGAGCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005644.2-858s1c1
Sequence:CCGGGCCATCTCAAAGAGGAGCAATCTCGAGATTGCTCCTCTTTGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005644.2-380s1c1
Sequence:CCGGCCTAATGAGCAGTTGGATGAACTCGAGTTCATCCAACTGCTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-202s1c1
Sequence:CCGGCTCCAATTTCTCATCCATAAACTCGAGTTTATGGATGAGAAATTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-260s1c1
Sequence:CCGGGCCAATAGTACTGCAGTGGTACTCGAGTACCACTGCAGTACTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005644.2-605s1c1
Sequence:CCGGGCTCACAAACAGAGAATGGCACTCGAGTGCCATTCTCTGTTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025579
VALIDATED
TAF12 MISSION shRNA Bacterial Glycerol Stock
TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-277s21c1
Sequence:CCGGCACAAGGCTCCATGGCCAATACTCGAGTATTGGCCATGGAGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025579.3-449s21c1
Sequence:CCGGGCTACAGATCGCTGATGATTTCTCGAGAAATCATCAGCGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-362s21c1
Sequence:CCGGCCAGGTATTGACCAAGAAGAACTCGAGTTCTTCTTGGTCAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-233s21c1
Sequence:CCGGCTCCAGTTTCTCATCTGTAAACTCGAGTTTACAGATGAGAAACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025579.3-774s21c1
Sequence:CCGGGCTTTACAGAGAAGCATATATCTCGAGATATATGCTTCTCTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025579.1-412s1c1
Sequence:CCGGGCTACAGATCGCTGATGATTTCTCGAGAAATCATCAGCGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-325s1c1
Sequence:CCGGCCAGGTATTGACCAAGAAGAACTCGAGTTCTTCTTGGTCAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-587s1c1
Sequence:CCGGTGTACCACAGAGGCTCACAAACTCGAGTTTGTGAGCCTCTGTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-359s1c1
Sequence:CCGGGTAAGAGAAGTAGATCCTAATCTCGAGATTAGGATCTACTTCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-595s1c1
Sequence:CCGGAGAGGCTCACAAACAGAGAATCTCGAGATTCTCTGTTTGTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025579
VALIDATED
TAF12 MISSION shRNA shRNA Plasmid DNA
TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-277s21c1
Sequence:CCGGCACAAGGCTCCATGGCCAATACTCGAGTATTGGCCATGGAGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025579.3-449s21c1
Sequence:CCGGGCTACAGATCGCTGATGATTTCTCGAGAAATCATCAGCGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-362s21c1
Sequence:CCGGCCAGGTATTGACCAAGAAGAACTCGAGTTCTTCTTGGTCAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-233s21c1
Sequence:CCGGCTCCAGTTTCTCATCTGTAAACTCGAGTTTACAGATGAGAAACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025579.3-774s21c1
Sequence:CCGGGCTTTACAGAGAAGCATATATCTCGAGATATATGCTTCTCTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025579.1-412s1c1
Sequence:CCGGGCTACAGATCGCTGATGATTTCTCGAGAAATCATCAGCGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-325s1c1
Sequence:CCGGCCAGGTATTGACCAAGAAGAACTCGAGTTCTTCTTGGTCAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-587s1c1
Sequence:CCGGTGTACCACAGAGGCTCACAAACTCGAGTTTGTGAGCCTCTGTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-359s1c1
Sequence:CCGGGTAAGAGAAGTAGATCCTAATCTCGAGATTAGGATCTACTTCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-595s1c1
Sequence:CCGGAGAGGCTCACAAACAGAGAATCTCGAGATTCTCTGTTTGTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025579
VALIDATED
TAF12 MISSION shRNA Lentiviral Transduction Particles
TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-277s21c1
Sequence:CCGGCACAAGGCTCCATGGCCAATACTCGAGTATTGGCCATGGAGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025579.3-449s21c1
Sequence:CCGGGCTACAGATCGCTGATGATTTCTCGAGAAATCATCAGCGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-362s21c1
Sequence:CCGGCCAGGTATTGACCAAGAAGAACTCGAGTTCTTCTTGGTCAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025579.3-233s21c1
Sequence:CCGGCTCCAGTTTCTCATCTGTAAACTCGAGTTTACAGATGAGAAACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025579.3-774s21c1
Sequence:CCGGGCTTTACAGAGAAGCATATATCTCGAGATATATGCTTCTCTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025579.1-412s1c1
Sequence:CCGGGCTACAGATCGCTGATGATTTCTCGAGAAATCATCAGCGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-325s1c1
Sequence:CCGGCCAGGTATTGACCAAGAAGAACTCGAGTTCTTCTTGGTCAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-587s1c1
Sequence:CCGGTGTACCACAGAGGCTCACAAACTCGAGTTTGTGAGCCTCTGTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-359s1c1
Sequence:CCGGGTAAGAGAAGTAGATCCTAATCTCGAGATTAGGATCTACTTCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025579.1-595s1c1
Sequence:CCGGAGAGGCTCACAAACAGAGAATCTCGAGATTCTCTGTTTGTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks