EMAIL THIS PAGE TO A FRIEND

TAF13

TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa

Synonyms: TAF(II)18 TAF2K TAFII-18 TAFII18
UniProtKB ID: Q15543, B2R5E5, Q5TYV6
Gene ID:
Human(6884) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit associated with a subset of TFIID complexes. This subunit interacts with TBP and with two other small subunits of TFIID, TAF10 and TAF11. There is a pseudogene located on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(99730) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(310784) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor
fruit fly(35297) TBP-associated factor 13
domestic cat(101097078) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
dog(100688743) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
chicken(418365) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Zebrafish(324153) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Thale Cress(837962) TBP-associated factor 13
domestic guinea pig(100728481) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
naked mole-rat(101723138) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
cow(513065) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
sheep(101102102) TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496381 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005645 Rosetta Predictions human pricing
NM_001107716 Rosetta Predictions rat pricing
NM_025444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044722 predicted 332
2 SASI_Hs01_00044723 predicted 256
3 SASI_Hs01_00044724 predicted 205
4 SASI_Hs01_00044725 predicted 210
5 SASI_Hs02_00339998 predicted 348
6 SASI_Hs01_00044727 predicted 300
7 SASI_Hs02_00339999 predicted 344
8 SASI_Hs02_00340000 predicted 207
9 SASI_Hs02_00340001 predicted 203
10 SASI_Hs01_00044729 predicted 352
11 SASI_Hs01_00044721 predicted 247
12 SASI_Hs01_00044726 predicted 296
13 SASI_Hs01_00044728 predicted 241
14 SASI_Hs01_00044730 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231565 predicted 709
2 SASI_Rn02_00231566 predicted 724
3 SASI_Rn02_00231567 predicted 610
4 SASI_Rn02_00231568 predicted 683
5 SASI_Rn02_00231569 predicted 852
6 SASI_Rn02_00231570 predicted 820
7 SASI_Rn02_00231571 predicted 941
8 SASI_Rn02_00231572 predicted 705
9 SASI_Rn02_00231573 predicted 770
10 SASI_Rn02_00231574 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158870 predicted 299
2 SASI_Mm01_00158871 predicted 393
3 SASI_Mm01_00158873 predicted 669
4 SASI_Mm02_00328272 predicted 204
5 SASI_Mm01_00158874 predicted 464
6 SASI_Mm01_00158875 predicted 642
7 SASI_Mm01_00158876 predicted 479
8 SASI_Mm01_00158877 predicted 562
9 SASI_Mm01_00158878 predicted 339
10 SASI_Mm01_00158879 predicted 384
11 SASI_Mm01_00158872 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496381
TAF13 MISSION shRNA Bacterial Glycerol Stock
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496381.1-604s1c1
Sequence:CCGGGCCTGCCTTTATATTACCATACTCGAGTATGGTAATATAAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-164s1c1
Sequence:CCGGCGATGTATGATGTATGGCTTTCTCGAGAAAGCCATACATCATACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-291s1c1
Sequence:CCGGGTCGAGTACAAGTTGAAGATACTCGAGTATCTTCAACTTGTACTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-269s1c1
Sequence:CCGGGCAATGTCAATTGGAAGACAACTCGAGTTGTCTTCCAATTGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-348s1c1
Sequence:CCGGCCAGGGTTAAAGACTTGCTTACTCGAGTAAGCAAGTCTTTAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496381
TAF13 MISSION shRNA shRNA Plasmid DNA
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496381.1-604s1c1
Sequence:CCGGGCCTGCCTTTATATTACCATACTCGAGTATGGTAATATAAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-164s1c1
Sequence:CCGGCGATGTATGATGTATGGCTTTCTCGAGAAAGCCATACATCATACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-291s1c1
Sequence:CCGGGTCGAGTACAAGTTGAAGATACTCGAGTATCTTCAACTTGTACTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-269s1c1
Sequence:CCGGGCAATGTCAATTGGAAGACAACTCGAGTTGTCTTCCAATTGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-348s1c1
Sequence:CCGGCCAGGGTTAAAGACTTGCTTACTCGAGTAAGCAAGTCTTTAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496381
TAF13 MISSION shRNA Lentiviral Transduction Particles
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496381.1-604s1c1
Sequence:CCGGGCCTGCCTTTATATTACCATACTCGAGTATGGTAATATAAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-164s1c1
Sequence:CCGGCGATGTATGATGTATGGCTTTCTCGAGAAAGCCATACATCATACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-291s1c1
Sequence:CCGGGTCGAGTACAAGTTGAAGATACTCGAGTATCTTCAACTTGTACTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-269s1c1
Sequence:CCGGGCAATGTCAATTGGAAGACAACTCGAGTTGTCTTCCAATTGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496381.1-348s1c1
Sequence:CCGGCCAGGGTTAAAGACTTGCTTACTCGAGTAAGCAAGTCTTTAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025444
VALIDATED
TAF13 MISSION shRNA Bacterial Glycerol Stock
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-262s1c1
Sequence:CCGGCGAGTGCAAGTTGAAGATATTCTCGAGAATATCTTCAACTTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-348s1c1
Sequence:CCGGAGAATTGAAACGGGCTAGAAACTCGAGTTTCTAGCCCGTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-133s1c1
Sequence:CCGGCGCTGTATGATGTATGGGTTTCTCGAGAAACCCATACATCATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-195s1c1
Sequence:CCGGCGAAGACCTTGTCATAGAGTTCTCGAGAACTCTATGACAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-522s1c1
Sequence:CCGGCCTGTCTTTATCTGACCATATCTCGAGATATGGTCAGATAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025444.2-521s21c1
Sequence:CCGGCCTGTCTTTATCTGACCATATCTCGAGATATGGTCAGATAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-347s21c1
Sequence:CCGGAGAATTGAAACGGGCTAGAAACTCGAGTTTCTAGCCCGTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-194s21c1
Sequence:CCGGCGAAGACCTTGTCATAGAGTTCTCGAGAACTCTATGACAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-132s21c1
Sequence:CCGGCGCTGTATGATGTATGGGTTTCTCGAGAAACCCATACATCATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025444
VALIDATED
TAF13 MISSION shRNA shRNA Plasmid DNA
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-262s1c1
Sequence:CCGGCGAGTGCAAGTTGAAGATATTCTCGAGAATATCTTCAACTTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-348s1c1
Sequence:CCGGAGAATTGAAACGGGCTAGAAACTCGAGTTTCTAGCCCGTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-133s1c1
Sequence:CCGGCGCTGTATGATGTATGGGTTTCTCGAGAAACCCATACATCATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-195s1c1
Sequence:CCGGCGAAGACCTTGTCATAGAGTTCTCGAGAACTCTATGACAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-522s1c1
Sequence:CCGGCCTGTCTTTATCTGACCATATCTCGAGATATGGTCAGATAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025444.2-521s21c1
Sequence:CCGGCCTGTCTTTATCTGACCATATCTCGAGATATGGTCAGATAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-347s21c1
Sequence:CCGGAGAATTGAAACGGGCTAGAAACTCGAGTTTCTAGCCCGTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-194s21c1
Sequence:CCGGCGAAGACCTTGTCATAGAGTTCTCGAGAACTCTATGACAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-132s21c1
Sequence:CCGGCGCTGTATGATGTATGGGTTTCTCGAGAAACCCATACATCATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025444
VALIDATED
TAF13 MISSION shRNA Lentiviral Transduction Particles
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-262s1c1
Sequence:CCGGCGAGTGCAAGTTGAAGATATTCTCGAGAATATCTTCAACTTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-348s1c1
Sequence:CCGGAGAATTGAAACGGGCTAGAAACTCGAGTTTCTAGCCCGTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-133s1c1
Sequence:CCGGCGCTGTATGATGTATGGGTTTCTCGAGAAACCCATACATCATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-195s1c1
Sequence:CCGGCGAAGACCTTGTCATAGAGTTCTCGAGAACTCTATGACAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025444.1-522s1c1
Sequence:CCGGCCTGTCTTTATCTGACCATATCTCGAGATATGGTCAGATAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025444.2-521s21c1
Sequence:CCGGCCTGTCTTTATCTGACCATATCTCGAGATATGGTCAGATAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-347s21c1
Sequence:CCGGAGAATTGAAACGGGCTAGAAACTCGAGTTTCTAGCCCGTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-194s21c1
Sequence:CCGGCGAAGACCTTGTCATAGAGTTCTCGAGAACTCTATGACAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025444.2-132s21c1
Sequence:CCGGCGCTGTATGATGTATGGGTTTCTCGAGAAACCCATACATCATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005645
TAF13 MISSION shRNA Bacterial Glycerol Stock
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000436268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-230s21c1
Sequence:CCGGGATCTTGTCATAGAGTTTATCCTCGAGGATAAACTCTATGACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-379s21c1
Sequence:CCGGAGAATTGAAACGAGCTAGAAACTCGAGTTTCTAGCTCGTTTCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-204s21c1
Sequence:CCGGATACTGAGTCAGTGGATATTCCTCGAGGAATATCCACTGACTCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-101s21c1
Sequence:CCGGGAAATTGGAGGAGGTGCAGAACTCGAGTTCTGCACCTCCTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005645
TAF13 MISSION shRNA shRNA Plasmid DNA
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000436268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-230s21c1
Sequence:CCGGGATCTTGTCATAGAGTTTATCCTCGAGGATAAACTCTATGACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-379s21c1
Sequence:CCGGAGAATTGAAACGAGCTAGAAACTCGAGTTTCTAGCTCGTTTCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-204s21c1
Sequence:CCGGATACTGAGTCAGTGGATATTCCTCGAGGAATATCCACTGACTCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-101s21c1
Sequence:CCGGGAAATTGGAGGAGGTGCAGAACTCGAGTTCTGCACCTCCTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005645
TAF13 MISSION shRNA Lentiviral Transduction Particles
TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000436268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-230s21c1
Sequence:CCGGGATCTTGTCATAGAGTTTATCCTCGAGGATAAACTCTATGACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-379s21c1
Sequence:CCGGAGAATTGAAACGAGCTAGAAACTCGAGTTTCTAGCTCGTTTCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-204s21c1
Sequence:CCGGATACTGAGTCAGTGGATATTCCTCGAGGAATATCCACTGACTCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005645.3-101s21c1
Sequence:CCGGGAAATTGGAGGAGGTGCAGAACTCGAGTTCTGCACCTCCTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks