EMAIL THIS PAGE TO A FRIEND

TAF15

TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa

Synonyms: Npl3 RBP56 TAF2N TAFII68
UniProtKB ID: Q92804, B2R837, Q92751
Gene ID:
Human(8148) Summary: This gene encodes a member of the TET family of RNA-binding proteins. The encoded protein plays a role in RNA polymerase II gene transcription as a component of a distinct subset of multi-subunit transcription initiation factor TFIID complexes. Translocations involving this gene play a role in acute leukemia and extraskeletal myxoid chondrosarcoma, and mutations in this gene may play a role in amyotrophic lateral sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(70439) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(287571) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Thale Cress(841452) TBP-associated factor 15
domestic cat(101085506) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
Horse(100071562) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
dog(491135) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
chicken(417522) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
cow(536067) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
sheep(101111819) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
naked mole-rat(101711796) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
domestic guinea pig(100713096) TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003487 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003487 Rosetta Predictions human pricing
NM_139215 Rosetta Predictions human pricing
NM_001105824 Rosetta Predictions rat pricing
NM_027427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054472 predicted 1876
2 SASI_Hs01_00054473 predicted 1881
3 SASI_Hs01_00054474 predicted 515
4 SASI_Hs01_00054476 predicted 994
5 SASI_Hs01_00054478 predicted 1870
6 SASI_Hs01_00054479 predicted 777
7 SASI_Hs01_00054480 predicted 719
8 SASI_Hs01_00054481 predicted 646
9 SASI_Hs02_00335762 predicted 735
10 SASI_Hs02_00335763 predicted 549
11 SASI_Hs01_00054475 predicted 578
12 SASI_Hs01_00054477 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039361 predicted 1889
2 SASI_Hs01_00039362 predicted 1891
3 SASI_Hs01_00039363 predicted 520
4 SASI_Hs01_00039365 predicted 999
5 SASI_Hs01_00039367 predicted 1879
6 SASI_Hs01_00039368 predicted 787
7 SASI_Hs01_00039369 predicted 726
8 SASI_Hs01_00039370 predicted 656
9 SASI_Hs02_00364238 predicted 744
10 SASI_Hs02_00364239 predicted 554
11 SASI_Hs01_00039364 predicted 586
12 SASI_Hs01_00039366 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212886 predicted 304
2 SASI_Rn02_00212887 predicted 1216
3 SASI_Rn02_00212888 predicted 208
4 SASI_Rn02_00212889 predicted 436
5 SASI_Rn02_00212890 predicted 1209
6 SASI_Rn02_00212891 predicted 761
7 SASI_Rn02_00212892 predicted 490
8 SASI_Rn02_00212893 predicted 1199
9 SASI_Rn02_00212894 predicted 518
10 SASI_Rn02_00212895 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070733 predicted 848
2 SASI_Mm01_00070734 predicted 494
3 SASI_Mm01_00070735 predicted 214
4 SASI_Mm02_00332173 predicted 785
5 SASI_Mm01_00070736 predicted 1521
6 SASI_Mm01_00070737 predicted 523
7 SASI_Mm01_00070738 predicted 818
8 SASI_Mm01_00070739 predicted 1028
9 SASI_Mm01_00070741 predicted 558
10 SASI_Mm01_00070742 predicted 267
11 SASI_Mm01_00070740 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027427
VALIDATED
TAF15 MISSION shRNA Bacterial Glycerol Stock
TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1850s21c1
Sequence:CCGGTGGGTAGTGAAATTGACATTTCTCGAGAAATGTCAATTTCACTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1039s21c1
Sequence:CCGGCCACTAGAAGGCCTGAATTTACTCGAGTAAATTCAGGCCTTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-522s21c1
Sequence:CCGGCAACAGTCTTACCATTCACAACTCGAGTTGTGAATGGTAAGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-474s21c1
Sequence:CCGGTATGATGAGCAGTCCAATTATCTCGAGATAATTGGACTGCTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1197s21c1
Sequence:CCGGGCTCGAAGAAACTCCTGTAATCTCGAGATTACAGGAGTTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-1783s1c1
Sequence:CCGGCTCCTTTGTCTCTGACATGATCTCGAGATCATGTCAGAGACAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-1198s1c1
Sequence:CCGGGCTCGAAGAAACTCCTGTAATCTCGAGATTACAGGAGTTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027427.1-764s1c1
Sequence:CCGGCAGAGTCTGATAATTCAGATACTCGAGTATCTGAATTATCAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-523s1c1
Sequence:CCGGCAACAGTCTTACCATTCACAACTCGAGTTGTGAATGGTAAGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-979s1c1
Sequence:CCGGGCAGCCATTGATTGGTTTGATCTCGAGATCAAACCAATCAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027427
VALIDATED
TAF15 MISSION shRNA shRNA Plasmid DNA
TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1850s21c1
Sequence:CCGGTGGGTAGTGAAATTGACATTTCTCGAGAAATGTCAATTTCACTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1039s21c1
Sequence:CCGGCCACTAGAAGGCCTGAATTTACTCGAGTAAATTCAGGCCTTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-522s21c1
Sequence:CCGGCAACAGTCTTACCATTCACAACTCGAGTTGTGAATGGTAAGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-474s21c1
Sequence:CCGGTATGATGAGCAGTCCAATTATCTCGAGATAATTGGACTGCTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1197s21c1
Sequence:CCGGGCTCGAAGAAACTCCTGTAATCTCGAGATTACAGGAGTTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-1783s1c1
Sequence:CCGGCTCCTTTGTCTCTGACATGATCTCGAGATCATGTCAGAGACAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-1198s1c1
Sequence:CCGGGCTCGAAGAAACTCCTGTAATCTCGAGATTACAGGAGTTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027427.1-764s1c1
Sequence:CCGGCAGAGTCTGATAATTCAGATACTCGAGTATCTGAATTATCAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-523s1c1
Sequence:CCGGCAACAGTCTTACCATTCACAACTCGAGTTGTGAATGGTAAGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-979s1c1
Sequence:CCGGGCAGCCATTGATTGGTTTGATCTCGAGATCAAACCAATCAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027427
VALIDATED
TAF15 MISSION shRNA Lentiviral Transduction Particles
TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1850s21c1
Sequence:CCGGTGGGTAGTGAAATTGACATTTCTCGAGAAATGTCAATTTCACTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1039s21c1
Sequence:CCGGCCACTAGAAGGCCTGAATTTACTCGAGTAAATTCAGGCCTTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-522s21c1
Sequence:CCGGCAACAGTCTTACCATTCACAACTCGAGTTGTGAATGGTAAGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-474s21c1
Sequence:CCGGTATGATGAGCAGTCCAATTATCTCGAGATAATTGGACTGCTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027427.2-1197s21c1
Sequence:CCGGGCTCGAAGAAACTCCTGTAATCTCGAGATTACAGGAGTTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-1783s1c1
Sequence:CCGGCTCCTTTGTCTCTGACATGATCTCGAGATCATGTCAGAGACAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-1198s1c1
Sequence:CCGGGCTCGAAGAAACTCCTGTAATCTCGAGATTACAGGAGTTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027427.1-764s1c1
Sequence:CCGGCAGAGTCTGATAATTCAGATACTCGAGTATCTGAATTATCAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-523s1c1
Sequence:CCGGCAACAGTCTTACCATTCACAACTCGAGTTGTGAATGGTAAGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027427.1-979s1c1
Sequence:CCGGGCAGCCATTGATTGGTTTGATCTCGAGATCAAACCAATCAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003487
VALIDATED
TAF15 MISSION shRNA Bacterial Glycerol Stock
TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-461s21c1
Sequence:CCGGATATGATGAGCAGTCAAATTACTCGAGTAATTTGACTGCTCATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-1884s21c1
Sequence:CCGGTGACATGATCCATAGTGAAATCTCGAGATTTCACTATGGATCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-1188s21c1
Sequence:CCGGGCTCGAAGGAATTCCTGCAATCTCGAGATTGCAGGAATTCCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-308s21c1
Sequence:CCGGATATAGCCAGCAACCATATAACTCGAGTTATATGGTTGCTGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003487.2-1160s21c1
Sequence:CCGGTAATCCGTCATGCGGAAATATCTCGAGATATTTCCGCATGACGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-520s1c1
Sequence:CCGGCCTATCATTCACAAAGGGAAACTCGAGTTTCCCTTTGTGAATGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-247s1c1
Sequence:CCGGCCAGTTATGGACAAAGTTATTCTCGAGAATAACTTTGTCCATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-1188s1c1
Sequence:CCGGGCTCGAAGGAATTCCTGCAATCTCGAGATTGCAGGAATTCCTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-567s1c1
Sequence:CCGGCGTCGTGATGTGAGTAGGTATCTCGAGATACCTACTCACATCACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-125s1c1
Sequence:CCGGGCAGCAAAGTTATTCTACCTACTCGAGTAGGTAGAATAACTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003487
VALIDATED
TAF15 MISSION shRNA shRNA Plasmid DNA
TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-461s21c1
Sequence:CCGGATATGATGAGCAGTCAAATTACTCGAGTAATTTGACTGCTCATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-1884s21c1
Sequence:CCGGTGACATGATCCATAGTGAAATCTCGAGATTTCACTATGGATCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-1188s21c1
Sequence:CCGGGCTCGAAGGAATTCCTGCAATCTCGAGATTGCAGGAATTCCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-308s21c1
Sequence:CCGGATATAGCCAGCAACCATATAACTCGAGTTATATGGTTGCTGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003487.2-1160s21c1
Sequence:CCGGTAATCCGTCATGCGGAAATATCTCGAGATATTTCCGCATGACGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-520s1c1
Sequence:CCGGCCTATCATTCACAAAGGGAAACTCGAGTTTCCCTTTGTGAATGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-247s1c1
Sequence:CCGGCCAGTTATGGACAAAGTTATTCTCGAGAATAACTTTGTCCATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-1188s1c1
Sequence:CCGGGCTCGAAGGAATTCCTGCAATCTCGAGATTGCAGGAATTCCTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-567s1c1
Sequence:CCGGCGTCGTGATGTGAGTAGGTATCTCGAGATACCTACTCACATCACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-125s1c1
Sequence:CCGGGCAGCAAAGTTATTCTACCTACTCGAGTAGGTAGAATAACTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003487
VALIDATED
TAF15 MISSION shRNA Lentiviral Transduction Particles
TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-461s21c1
Sequence:CCGGATATGATGAGCAGTCAAATTACTCGAGTAATTTGACTGCTCATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-1884s21c1
Sequence:CCGGTGACATGATCCATAGTGAAATCTCGAGATTTCACTATGGATCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-1188s21c1
Sequence:CCGGGCTCGAAGGAATTCCTGCAATCTCGAGATTGCAGGAATTCCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003487.2-308s21c1
Sequence:CCGGATATAGCCAGCAACCATATAACTCGAGTTATATGGTTGCTGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003487.2-1160s21c1
Sequence:CCGGTAATCCGTCATGCGGAAATATCTCGAGATATTTCCGCATGACGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-520s1c1
Sequence:CCGGCCTATCATTCACAAAGGGAAACTCGAGTTTCCCTTTGTGAATGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-247s1c1
Sequence:CCGGCCAGTTATGGACAAAGTTATTCTCGAGAATAACTTTGTCCATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-1188s1c1
Sequence:CCGGGCTCGAAGGAATTCCTGCAATCTCGAGATTGCAGGAATTCCTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-567s1c1
Sequence:CCGGCGTCGTGATGTGAGTAGGTATCTCGAGATACCTACTCACATCACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003487.2-125s1c1
Sequence:CCGGGCAGCAAAGTTATTCTACCTACTCGAGTAGGTAGAATAACTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks