EMAIL THIS PAGE TO A FRIEND

TAF1

TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa

Synonyms: BA2R CCG1 CCGS DYT3 DYT3/TAF1 KAT4 N-TAF1 NSCL2 OF P250 TAF2A TAFII250 XDP
Gene ID:
Human(6872) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is the basal transcription factor TFIID, which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes the largest subunit of TFIID. This subunit binds to core promoter sequences encompassing the transcription start site. It also binds to activators and other transcriptional regulators, and these interactions affect the rate of transcription initiation. This subunit contains two independent protein kinase domains at the N and C-terminals, but also possesses acetyltransferase activity and can act as a ubiquitin-activating/conjugating enzyme. This gene is part of a complex transcriptional unit (TAF1/DYT3), wherein some products share exons with TAF1 as well as additional exons downstream.[provided by RefSeq, Aug 2009]
Mouse(270627) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(317256) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor
fruit fly(40813) TBP-associated factor 1
dog(491950) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Horse(100056106) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
domestic cat(101093583) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Zebrafish(555452) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor
chicken(422204) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
domestic guinea pig(100736214) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Domestic Rabbit(100348935) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
naked mole-rat(101705178) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
cow(504792) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
cow(785085) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
sheep(101123273) TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
218 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0046 AQUA Peptide TPQDLTG[K] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085961 MISSION® esiRNA esiRNA targeting mouse Taf1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004606 Rosetta Predictions human pricing
NM_138923 Rosetta Predictions human pricing
XM_001061884 Rosetta Predictions rat pricing
XM_228551 Rosetta Predictions rat pricing
NM_001081008 Rosetta Predictions mouse pricing
XM_001000569 Rosetta Predictions mouse pricing
XM_194622 Rosetta Predictions mouse pricing
XM_886564 Rosetta Predictions mouse pricing
XM_896863 Rosetta Predictions mouse pricing
XM_896872 Rosetta Predictions mouse pricing
XM_896882 Rosetta Predictions mouse pricing
XM_896906 Rosetta Predictions mouse pricing
XM_896918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020711 predicted 2317
2 SASI_Hs01_00020713 predicted 4915
3 SASI_Hs01_00020714 predicted 5822
4 SASI_Hs01_00020715 predicted 1426
5 SASI_Hs01_00020716 predicted 5156
6 SASI_Hs01_00020712 predicted 5824
7 SASI_Hs01_00020717 predicted 2356
8 SASI_Hs01_00020718 predicted 562
9 SASI_Hs01_00020719 predicted 563
10 SASI_Hs02_00337985 predicted 549
11 SASI_Hs01_00020720 predicted 5799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199386 predicted 2251
2 SASI_Hs01_00199388 predicted 4851
3 SASI_Hs01_00199389 predicted 5759
4 SASI_Hs01_00199390 predicted 1358
5 SASI_Hs01_00199391 predicted 5095
6 SASI_Hs01_00199387 predicted 5760
7 SASI_Hs01_00199392 predicted 2294
8 SASI_Hs02_00363993 predicted 547
9 SASI_Hs01_00199393 predicted 5729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301642 predicted 2442
2 SASI_Rn02_00301643 predicted 1162
3 SASI_Rn02_00301644 predicted 2899
4 SASI_Rn02_00301645 predicted 1498
5 SASI_Rn02_00301646 predicted 4583
6 SASI_Rn02_00301647 predicted 4766
7 SASI_Rn02_00301648 predicted 1895
8 SASI_Rn02_00301649 predicted 4432
9 SASI_Rn02_00301650 predicted 2366
10 SASI_Rn02_00301651 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385230 predicted 2440
2 SASI_Rn02_00385231 predicted 3579
3 SASI_Rn02_00385232 predicted 2893
4 SASI_Rn02_00385233 predicted 4581
5 SASI_Rn02_00385234 predicted 4764
6 SASI_Rn02_00385235 predicted 2766
7 SASI_Rn02_00385236 predicted 3650
8 SASI_Rn02_00385237 predicted 4433
9 SASI_Rn02_00385238 predicted 2367
10 SASI_Rn02_00385239 predicted 2881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294326 predicted 2378
2 SASI_Mm02_00294327 predicted 3337
3 SASI_Mm02_00294328 predicted 1126
4 SASI_Mm02_00294329 predicted 2946
5 SASI_Mm02_00294330 predicted 5325
6 SASI_Mm02_00294331 predicted 2415
7 SASI_Mm02_00294332 predicted 1540
8 SASI_Mm02_00294333 predicted 4640
9 SASI_Mm02_00294334 predicted 4825
10 SASI_Mm02_00294335 predicted 2814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225608 predicted 4496
2 SASI_Mm01_00225609 predicted 3334
3 SASI_Mm01_00225610 predicted 5556
4 SASI_Mm01_00225611 predicted 4339
5 SASI_Mm01_00225612 predicted 4652
6 SASI_Mm01_00225613 predicted 4825
7 SASI_Mm01_00225614 predicted 4794
8 SASI_Mm01_00225615 predicted 4405
9 SASI_Mm01_00225616 predicted 4814
10 SASI_Mm01_00225617 predicted 3240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263954 predicted 3299
2 SASI_Mm01_00263955 predicted 5500
3 SASI_Mm01_00263956 predicted 4278
4 SASI_Mm01_00263957 predicted 4589
5 SASI_Mm01_00263958 predicted 4767
6 SASI_Mm01_00263959 predicted 3650
7 SASI_Mm01_00263960 predicted 4744
8 SASI_Mm01_00263961 predicted 4351
9 SASI_Mm01_00263962 predicted 3198
10 SASI_Mm01_00263963 predicted 3358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220097 predicted 3257
2 SASI_Mm01_00220098 predicted 5462
3 SASI_Mm01_00220099 predicted 4245
4 SASI_Mm01_00220100 predicted 4554
5 SASI_Mm01_00220101 predicted 4734
6 SASI_Mm01_00220102 predicted 3618
7 SASI_Mm01_00220103 predicted 4704
8 SASI_Mm01_00220104 predicted 4312
9 SASI_Mm01_00220105 predicted 3162
10 SASI_Mm01_00220106 predicted 3317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274765 predicted 1299
2 SASI_Mm01_00274766 predicted 394
3 SASI_Mm01_00274767 predicted 578
4 SASI_Mm01_00274768 predicted 742
5 SASI_Mm01_00274769 predicted 522
6 SASI_Mm01_00274770 predicted 550
7 SASI_Mm01_00274771 predicted 1526
8 SASI_Mm01_00274772 predicted 566
9 SASI_Mm01_00274773 predicted 1602
10 SASI_Mm01_00274774 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210146 predicted 2651
2 SASI_Mm01_00210147 predicted 3716
3 SASI_Mm01_00210148 predicted 2499
4 SASI_Mm01_00210149 predicted 2801
5 SASI_Mm01_00210150 predicted 2980
6 SASI_Mm01_00210151 predicted 3148
7 SASI_Mm01_00210152 predicted 2933
8 SASI_Mm01_00210153 predicted 2953
9 SASI_Mm01_00210154 predicted 3932
10 SASI_Mm01_00210155 predicted 2563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277468 predicted 118
2 SASI_Mm01_00277469 predicted 483
3 SASI_Mm01_00277470 predicted 248
4 SASI_Mm01_00277471 predicted 260
5 SASI_Mm01_00277472 predicted 595
6 SASI_Mm01_00277473 predicted 365
7 SASI_Mm01_00277474 predicted 311
8 SASI_Mm01_00277475 predicted 639
9 SASI_Mm01_00277476 predicted 602
10 SASI_Mm01_00277477 predicted 49
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206586 predicted 1355
2 SASI_Mm01_00206587 predicted 2413
3 SASI_Mm01_00206588 predicted 1196
4 SASI_Mm01_00206589 predicted 1509
5 SASI_Mm01_00206590 predicted 1692
6 SASI_Mm01_00206591 predicted 1855
7 SASI_Mm01_00206592 predicted 1640
8 SASI_Mm01_00206593 predicted 1655
9 SASI_Mm01_00206594 predicted 2631
10 SASI_Mm01_00206595 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212955 predicted 604
2 SASI_Mm01_00212956 predicted 2807
3 SASI_Mm01_00212957 predicted 1590
4 SASI_Mm01_00212958 predicted 1904
5 SASI_Mm01_00212959 predicted 2074
6 SASI_Mm01_00212960 predicted 958
7 SASI_Mm01_00212961 predicted 2048
8 SASI_Mm01_00212962 predicted 1652
9 SASI_Mm01_00212963 predicted 502
10 SASI_Mm01_00212964 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004606
VALIDATED
TAF1 MISSION shRNA Bacterial Glycerol Stock
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-5814s1c1
Sequence:CCGGGTACAGTATCTGATCCTGAAACTCGAGTTTCAGGATCAGATACTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-4753s1c1
Sequence:CCGGCCAATGGATTTAGAGACCATACTCGAGTATGGTCTCTAAATCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-2331s1c1
Sequence:CCGGGCTGCAAGCATTTGAGAACAACTCGAGTTGTTCTCAAATGCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-1426s1c1
Sequence:CCGGCCTTCTAGCATGACTAGGAATCTCGAGATTCCTAGTCATGCTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-1480s1c1
Sequence:CCGGGCCACTCTTGATGATGACAAACTCGAGTTTGTCATCATCAAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004606.2-5776s1c1
Sequence:CCGGGCCTAGGTGGTTCACCTTTCCCTCGAGGGAAAGGTGAACCACCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004606.2-2132s1c1
Sequence:CCGGGCAAAGATGGTGATCTTATTCCTCGAGGAATAAGATCACCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004606.2-5916s1c1
Sequence:CCGGCAATGTCACCCTTTGATTTAACTCGAGTTAAATCAAAGGGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004606.2-4193s1c1
Sequence:CCGGCCACTGTTCACTGTGACTATTCTCGAGAATAGTCACAGTGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004606.3-1480s21c1
Sequence:CCGGGCCACTCTTGATGATGACAAACTCGAGTTTGTCATCATCAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004606.3-5776s21c1
Sequence:CCGGGCCTAGGTGGTTCACCTTTCCCTCGAGGGAAAGGTGAACCACCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004606.3-5916s21c1
Sequence:CCGGCAATGTCACCCTTTGATTTAACTCGAGTTAAATCAAAGGGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004606.3-4193s21c1
Sequence:CCGGCCACTGTTCACTGTGACTATTCTCGAGAATAGTCACAGTGAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004606.3-5814s21c1
Sequence:CCGGGTACAGTATCTGATCCTGAAACTCGAGTTTCAGGATCAGATACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004606
VALIDATED
TAF1 MISSION shRNA shRNA Plasmid DNA
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-5814s1c1
Sequence:CCGGGTACAGTATCTGATCCTGAAACTCGAGTTTCAGGATCAGATACTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-4753s1c1
Sequence:CCGGCCAATGGATTTAGAGACCATACTCGAGTATGGTCTCTAAATCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-2331s1c1
Sequence:CCGGGCTGCAAGCATTTGAGAACAACTCGAGTTGTTCTCAAATGCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-1426s1c1
Sequence:CCGGCCTTCTAGCATGACTAGGAATCTCGAGATTCCTAGTCATGCTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-1480s1c1
Sequence:CCGGGCCACTCTTGATGATGACAAACTCGAGTTTGTCATCATCAAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004606.2-5776s1c1
Sequence:CCGGGCCTAGGTGGTTCACCTTTCCCTCGAGGGAAAGGTGAACCACCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004606.2-2132s1c1
Sequence:CCGGGCAAAGATGGTGATCTTATTCCTCGAGGAATAAGATCACCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004606.2-5916s1c1
Sequence:CCGGCAATGTCACCCTTTGATTTAACTCGAGTTAAATCAAAGGGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004606.2-4193s1c1
Sequence:CCGGCCACTGTTCACTGTGACTATTCTCGAGAATAGTCACAGTGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004606.3-1480s21c1
Sequence:CCGGGCCACTCTTGATGATGACAAACTCGAGTTTGTCATCATCAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004606.3-5776s21c1
Sequence:CCGGGCCTAGGTGGTTCACCTTTCCCTCGAGGGAAAGGTGAACCACCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004606.3-5916s21c1
Sequence:CCGGCAATGTCACCCTTTGATTTAACTCGAGTTAAATCAAAGGGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004606.3-4193s21c1
Sequence:CCGGCCACTGTTCACTGTGACTATTCTCGAGAATAGTCACAGTGAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004606.3-5814s21c1
Sequence:CCGGGTACAGTATCTGATCCTGAAACTCGAGTTTCAGGATCAGATACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004606
VALIDATED
TAF1 MISSION shRNA Lentiviral Transduction Particles
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-5814s1c1
Sequence:CCGGGTACAGTATCTGATCCTGAAACTCGAGTTTCAGGATCAGATACTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-4753s1c1
Sequence:CCGGCCAATGGATTTAGAGACCATACTCGAGTATGGTCTCTAAATCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-2331s1c1
Sequence:CCGGGCTGCAAGCATTTGAGAACAACTCGAGTTGTTCTCAAATGCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-1426s1c1
Sequence:CCGGCCTTCTAGCATGACTAGGAATCTCGAGATTCCTAGTCATGCTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004606.2-1480s1c1
Sequence:CCGGGCCACTCTTGATGATGACAAACTCGAGTTTGTCATCATCAAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004606.2-5776s1c1
Sequence:CCGGGCCTAGGTGGTTCACCTTTCCCTCGAGGGAAAGGTGAACCACCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004606.2-2132s1c1
Sequence:CCGGGCAAAGATGGTGATCTTATTCCTCGAGGAATAAGATCACCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004606.2-5916s1c1
Sequence:CCGGCAATGTCACCCTTTGATTTAACTCGAGTTAAATCAAAGGGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004606.2-4193s1c1
Sequence:CCGGCCACTGTTCACTGTGACTATTCTCGAGAATAGTCACAGTGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004606.3-1480s21c1
Sequence:CCGGGCCACTCTTGATGATGACAAACTCGAGTTTGTCATCATCAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004606.3-5776s21c1
Sequence:CCGGGCCTAGGTGGTTCACCTTTCCCTCGAGGGAAAGGTGAACCACCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004606.3-5916s21c1
Sequence:CCGGCAATGTCACCCTTTGATTTAACTCGAGTTAAATCAAAGGGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004606.3-4193s21c1
Sequence:CCGGCCACTGTTCACTGTGACTATTCTCGAGAATAGTCACAGTGAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004606.3-5814s21c1
Sequence:CCGGGTACAGTATCTGATCCTGAAACTCGAGTTTCAGGATCAGATACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194622
VALIDATED
TAF1 MISSION shRNA Bacterial Glycerol Stock
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-3933s1c1
Sequence:CCGGCGGGCACATGAGGACAAATAACTCGAGTTATTTGTCCTCATGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-278s1c1
Sequence:CCGGCCCTGGTAAATGATGAAGGATCTCGAGATCCTTCATCATTTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194622.4-4852s1c1
Sequence:CCGGGCCAACAGTGTTAAGTACAATCTCGAGATTGTACTTAACACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194622.4-6148s1c1
Sequence:CCGGGCCTTGTTGCTAAATAGATTACTCGAGTAATCTATTTAGCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-757s1c1
Sequence:CCGGGCTGGGATTATGCAGCATGATCTCGAGATCATGCTGCATAATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194622
VALIDATED
TAF1 MISSION shRNA shRNA Plasmid DNA
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-3933s1c1
Sequence:CCGGCGGGCACATGAGGACAAATAACTCGAGTTATTTGTCCTCATGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-278s1c1
Sequence:CCGGCCCTGGTAAATGATGAAGGATCTCGAGATCCTTCATCATTTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194622.4-4852s1c1
Sequence:CCGGGCCAACAGTGTTAAGTACAATCTCGAGATTGTACTTAACACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194622.4-6148s1c1
Sequence:CCGGGCCTTGTTGCTAAATAGATTACTCGAGTAATCTATTTAGCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-757s1c1
Sequence:CCGGGCTGGGATTATGCAGCATGATCTCGAGATCATGCTGCATAATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194622
VALIDATED
TAF1 MISSION shRNA Lentiviral Transduction Particles
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-3933s1c1
Sequence:CCGGCGGGCACATGAGGACAAATAACTCGAGTTATTTGTCCTCATGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-278s1c1
Sequence:CCGGCCCTGGTAAATGATGAAGGATCTCGAGATCCTTCATCATTTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194622.4-4852s1c1
Sequence:CCGGGCCAACAGTGTTAAGTACAATCTCGAGATTGTACTTAACACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194622.4-6148s1c1
Sequence:CCGGGCCTTGTTGCTAAATAGATTACTCGAGTAATCTATTTAGCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194622.4-757s1c1
Sequence:CCGGGCTGGGATTATGCAGCATGATCTCGAGATCATGCTGCATAATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081008
TAF1 MISSION shRNA Bacterial Glycerol Stock
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000363050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-2486s21c1
Sequence:CCGGTTCGAGAATTAGTGGATATTTCTCGAGAAATATCCACTAATTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-3177s21c1
Sequence:CCGGCAAGCAGCTTCTTCGTAAATTCTCGAGAATTTACGAAGAAGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-4341s21c1
Sequence:CCGGTTCTATCTTGGAGTCTATTATCTCGAGATAATAGACTCCAAGATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081008
TAF1 MISSION shRNA shRNA Plasmid DNA
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000363050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-2486s21c1
Sequence:CCGGTTCGAGAATTAGTGGATATTTCTCGAGAAATATCCACTAATTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-3177s21c1
Sequence:CCGGCAAGCAGCTTCTTCGTAAATTCTCGAGAATTTACGAAGAAGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-4341s21c1
Sequence:CCGGTTCTATCTTGGAGTCTATTATCTCGAGATAATAGACTCCAAGATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081008
TAF1 MISSION shRNA Lentiviral Transduction Particles
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000363050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-2486s21c1
Sequence:CCGGTTCGAGAATTAGTGGATATTTCTCGAGAAATATCCACTAATTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-3177s21c1
Sequence:CCGGCAAGCAGCTTCTTCGTAAATTCTCGAGAATTTACGAAGAAGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081008.1-4341s21c1
Sequence:CCGGTTCTATCTTGGAGTCTATTATCTCGAGATAATAGACTCCAAGATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks