EMAIL THIS PAGE TO A FRIEND

TAF1A

TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa

Synonyms: MGC:17061 RAFI48 SL1 TAFI48
UniProtKB ID: Q15573, B2RDZ8, D3DTB7, Q9NWA1
Gene ID:
Human(9015) Summary: This gene encodes a subunit of the RNA polymerase I complex, Selectivity Factor I (SLI). The encoded protein is a TATA box-binding protein-associated factor that plays a role in the assembly of the RNA polymerase I preinitiation complex. Alternate splicing results in multiple transcript variants encoding multiple isoforms.[provided by RefSeq, Jan 2011]
Mouse(21339) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A
Rat(360893) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A
Zebrafish(567105) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A
domestic cat(101097295) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Horse(100050174) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
dog(608850) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
chicken(421338) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
domestic guinea pig(100714318) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
naked mole-rat(101715902) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Domestic Rabbit(100351776) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
cow(505051) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
sheep(101106607) TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0048 AQUA Peptide AFVAGLLLG[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005681 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005681 Rosetta Predictions human pricing
NM_139352 Rosetta Predictions human pricing
NM_001037204 Rosetta Predictions rat pricing
NM_021466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033079 predicted 774
2 SASI_Hs01_00033080 predicted 856
3 SASI_Hs01_00033083 predicted 999
4 SASI_Hs01_00033085 predicted 784
5 SASI_Hs01_00033086 predicted 1118
6 SASI_Hs01_00033087 predicted 772
7 SASI_Hs01_00033088 predicted 963
8 SASI_Hs02_00340072 predicted 699
9 SASI_Hs02_00340073 predicted 703
10 SASI_Hs02_00340074 predicted 1422
11 SASI_Hs01_00033081 predicted 720
12 SASI_Hs01_00033082 predicted 1094
13 SASI_Hs01_00033084 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123671 predicted 612
2 SASI_Hs01_00123672 predicted 682
3 SASI_Hs01_00123675 predicted 834
4 SASI_Hs01_00123677 predicted 610
5 SASI_Hs01_00123678 predicted 945
6 SASI_Hs01_00123679 predicted 603
7 SASI_Hs01_00123680 predicted 790
8 SASI_Hs02_00364311 predicted 527
9 SASI_Hs02_00364312 predicted 529
10 SASI_Hs02_00364313 predicted 1258
11 SASI_Hs01_00123673 predicted 542
12 SASI_Hs01_00123674 predicted 926
13 SASI_Hs01_00123676 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091937 predicted 861
2 SASI_Rn01_00091939 predicted 1128
3 SASI_Rn02_00204314 predicted 1131
4 SASI_Rn01_00091940 predicted 623
5 SASI_Rn01_00091941 predicted 961
6 SASI_Rn01_00091942 predicted 959
7 SASI_Rn01_00091943 predicted 634
8 SASI_Rn01_00091945 predicted 693
9 SASI_Rn02_00204315 predicted 1129
10 SASI_Rn02_00204316 predicted 383
11 SASI_Rn01_00091938 predicted 1103
12 SASI_Rn01_00091944 predicted 810
13 SASI_Rn01_00091946 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326121 predicted 262
2 SASI_Mm02_00326122 predicted 1124
3 SASI_Mm02_00326123 predicted 1080
4 SASI_Mm02_00326124 predicted 589
5 SASI_Mm02_00326125 predicted 676
6 SASI_Mm02_00326126 predicted 730
7 SASI_Mm02_00326127 predicted 507
8 SASI_Mm02_00326128 predicted 316
9 SASI_Mm02_00326129 predicted 1577
10 SASI_Mm02_00326130 predicted 1273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005681
VALIDATED
TAF1A MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005681.2-1587s1c1
Sequence:CCGGGCTTGGTAGATAGTTATTGAACTCGAGTTCAATAACTATCTACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-1208s1c1
Sequence:CCGGCCGGATGCACTAAGAATATAACTCGAGTTATATTCTTAGTGCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-703s1c1
Sequence:CCGGCGGGAAATATTAATCAACCTTCTCGAGAAGGTTGATTAATATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-1326s1c1
Sequence:CCGGGCCAGGCTTTCATTTCAGCTACTCGAGTAGCTGAAATGAAAGCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-492s1c1
Sequence:CCGGGCTCGGAAGTGAAATTCTATTCTCGAGAATAGAATTTCACTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-570s21c1
Sequence:CCGGTATTGGCGTCATGAATTATTTCTCGAGAAATAATTCATGACGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1094s21c1
Sequence:CCGGAGATTGTACCATCTCATAAATCTCGAGATTTATGAGATGGTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005681.2-999s21c1
Sequence:CCGGATCAAATCCAAATGCCCATATCTCGAGATATGGGCATTTGGATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1433s21c1
Sequence:CCGGGTAGATATTTCCGGTATATTTCTCGAGAAATATACCGGAAATATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1067s21c1
Sequence:CCGGTGATAAGTGTGCTTAAGATTTCTCGAGAAATCTTAAGCACACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005681.2-597s21c1
Sequence:CCGGCTCCTTACAACATGCATTATACTCGAGTATAATGCATGTTGTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-958s21c1
Sequence:CCGGCAAGAGGTACTCACCAATTATCTCGAGATAATTGGTGAGTACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1712s21c1
Sequence:CCGGCCTTTGCTCTTTGTAACTATGCTCGAGCATAGTTACAAAGAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-622s21c1
Sequence:CCGGCTGCATCATGGAATGCTTAAACTCGAGTTTAAGCATTCCATGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1689s21c1
Sequence:CCGGTAGCTAGAGAAACAATATTACCTCGAGGTAATATTGTTTCTCTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005681
VALIDATED
TAF1A MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005681.2-1587s1c1
Sequence:CCGGGCTTGGTAGATAGTTATTGAACTCGAGTTCAATAACTATCTACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-1208s1c1
Sequence:CCGGCCGGATGCACTAAGAATATAACTCGAGTTATATTCTTAGTGCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-703s1c1
Sequence:CCGGCGGGAAATATTAATCAACCTTCTCGAGAAGGTTGATTAATATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-1326s1c1
Sequence:CCGGGCCAGGCTTTCATTTCAGCTACTCGAGTAGCTGAAATGAAAGCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-492s1c1
Sequence:CCGGGCTCGGAAGTGAAATTCTATTCTCGAGAATAGAATTTCACTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-570s21c1
Sequence:CCGGTATTGGCGTCATGAATTATTTCTCGAGAAATAATTCATGACGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1094s21c1
Sequence:CCGGAGATTGTACCATCTCATAAATCTCGAGATTTATGAGATGGTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005681.2-999s21c1
Sequence:CCGGATCAAATCCAAATGCCCATATCTCGAGATATGGGCATTTGGATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1433s21c1
Sequence:CCGGGTAGATATTTCCGGTATATTTCTCGAGAAATATACCGGAAATATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1067s21c1
Sequence:CCGGTGATAAGTGTGCTTAAGATTTCTCGAGAAATCTTAAGCACACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005681.2-597s21c1
Sequence:CCGGCTCCTTACAACATGCATTATACTCGAGTATAATGCATGTTGTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-958s21c1
Sequence:CCGGCAAGAGGTACTCACCAATTATCTCGAGATAATTGGTGAGTACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1712s21c1
Sequence:CCGGCCTTTGCTCTTTGTAACTATGCTCGAGCATAGTTACAAAGAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-622s21c1
Sequence:CCGGCTGCATCATGGAATGCTTAAACTCGAGTTTAAGCATTCCATGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1689s21c1
Sequence:CCGGTAGCTAGAGAAACAATATTACCTCGAGGTAATATTGTTTCTCTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005681
VALIDATED
TAF1A MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005681.2-1587s1c1
Sequence:CCGGGCTTGGTAGATAGTTATTGAACTCGAGTTCAATAACTATCTACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-1208s1c1
Sequence:CCGGCCGGATGCACTAAGAATATAACTCGAGTTATATTCTTAGTGCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-703s1c1
Sequence:CCGGCGGGAAATATTAATCAACCTTCTCGAGAAGGTTGATTAATATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-1326s1c1
Sequence:CCGGGCCAGGCTTTCATTTCAGCTACTCGAGTAGCTGAAATGAAAGCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005681.2-492s1c1
Sequence:CCGGGCTCGGAAGTGAAATTCTATTCTCGAGAATAGAATTTCACTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-570s21c1
Sequence:CCGGTATTGGCGTCATGAATTATTTCTCGAGAAATAATTCATGACGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1094s21c1
Sequence:CCGGAGATTGTACCATCTCATAAATCTCGAGATTTATGAGATGGTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005681.2-999s21c1
Sequence:CCGGATCAAATCCAAATGCCCATATCTCGAGATATGGGCATTTGGATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1433s21c1
Sequence:CCGGGTAGATATTTCCGGTATATTTCTCGAGAAATATACCGGAAATATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1067s21c1
Sequence:CCGGTGATAAGTGTGCTTAAGATTTCTCGAGAAATCTTAAGCACACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005681.2-597s21c1
Sequence:CCGGCTCCTTACAACATGCATTATACTCGAGTATAATGCATGTTGTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-958s21c1
Sequence:CCGGCAAGAGGTACTCACCAATTATCTCGAGATAATTGGTGAGTACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1712s21c1
Sequence:CCGGCCTTTGCTCTTTGTAACTATGCTCGAGCATAGTTACAAAGAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-622s21c1
Sequence:CCGGCTGCATCATGGAATGCTTAAACTCGAGTTTAAGCATTCCATGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005681.2-1689s21c1
Sequence:CCGGTAGCTAGAGAAACAATATTACCTCGAGGTAATATTGTTTCTCTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021466
VALIDATED
TAF1A MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021466.1-2178s1c1
Sequence:CCGGGCTGCCTTGTAGTTATTGTTACTCGAGTAACAATAACTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021466.1-1168s1c1
Sequence:CCGGGCAAAGTATCTGAAGCAGATACTCGAGTATCTGCTTCAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021466.1-951s1c1
Sequence:CCGGCGAGTTTCTCAAGAGAGAGAACTCGAGTTCTCTCTCTTGAGAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021466.1-1028s1c1
Sequence:CCGGCCCATACACTAATGTTAGAATCTCGAGATTCTAACATTAGTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021466.1-936s1c1
Sequence:CCGGCCACGTCTACTTATACGAGTTCTCGAGAACTCGTATAAGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-363s21c1
Sequence:CCGGCAGACGACAAGTGCTTGTTTACTCGAGTAAACAAGCACTTGTCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-977s21c1
Sequence:CCGGCCGAGAGATGCTCACCAATTACTCGAGTAATTGGTGAGCATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021466.2-1895s21c1
Sequence:CCGGGAGATGTGGTTGACCTTAAAGCTCGAGCTTTAAGGTCAACCACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-1220s21c1
Sequence:CCGGGGACTTCGCTGGATGCAATAACTCGAGTTATTGCATCCAGCGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-1036s21c1
Sequence:CCGGACGTCTACTTATACGAGTTTCCTCGAGGAAACTCGTATAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021466
VALIDATED
TAF1A MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021466.1-2178s1c1
Sequence:CCGGGCTGCCTTGTAGTTATTGTTACTCGAGTAACAATAACTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021466.1-1168s1c1
Sequence:CCGGGCAAAGTATCTGAAGCAGATACTCGAGTATCTGCTTCAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021466.1-951s1c1
Sequence:CCGGCGAGTTTCTCAAGAGAGAGAACTCGAGTTCTCTCTCTTGAGAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021466.1-1028s1c1
Sequence:CCGGCCCATACACTAATGTTAGAATCTCGAGATTCTAACATTAGTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021466.1-936s1c1
Sequence:CCGGCCACGTCTACTTATACGAGTTCTCGAGAACTCGTATAAGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-363s21c1
Sequence:CCGGCAGACGACAAGTGCTTGTTTACTCGAGTAAACAAGCACTTGTCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-977s21c1
Sequence:CCGGCCGAGAGATGCTCACCAATTACTCGAGTAATTGGTGAGCATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021466.2-1895s21c1
Sequence:CCGGGAGATGTGGTTGACCTTAAAGCTCGAGCTTTAAGGTCAACCACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-1220s21c1
Sequence:CCGGGGACTTCGCTGGATGCAATAACTCGAGTTATTGCATCCAGCGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-1036s21c1
Sequence:CCGGACGTCTACTTATACGAGTTTCCTCGAGGAAACTCGTATAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021466
VALIDATED
TAF1A MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021466.1-2178s1c1
Sequence:CCGGGCTGCCTTGTAGTTATTGTTACTCGAGTAACAATAACTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021466.1-1168s1c1
Sequence:CCGGGCAAAGTATCTGAAGCAGATACTCGAGTATCTGCTTCAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021466.1-951s1c1
Sequence:CCGGCGAGTTTCTCAAGAGAGAGAACTCGAGTTCTCTCTCTTGAGAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021466.1-1028s1c1
Sequence:CCGGCCCATACACTAATGTTAGAATCTCGAGATTCTAACATTAGTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021466.1-936s1c1
Sequence:CCGGCCACGTCTACTTATACGAGTTCTCGAGAACTCGTATAAGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-363s21c1
Sequence:CCGGCAGACGACAAGTGCTTGTTTACTCGAGTAAACAAGCACTTGTCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-977s21c1
Sequence:CCGGCCGAGAGATGCTCACCAATTACTCGAGTAATTGGTGAGCATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021466.2-1895s21c1
Sequence:CCGGGAGATGTGGTTGACCTTAAAGCTCGAGCTTTAAGGTCAACCACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-1220s21c1
Sequence:CCGGGGACTTCGCTGGATGCAATAACTCGAGTTATTGCATCCAGCGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021466.2-1036s21c1
Sequence:CCGGACGTCTACTTATACGAGTTTCCTCGAGGAAACTCGTATAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks