EMAIL THIS PAGE TO A FRIEND

TAF1B

TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa

Synonyms: MGC:9349 RAF1B RAFI63 SL1 TAFI63
UniProtKB ID: Q53T94, B4DI42, F8WD72, Q15574, Q8WVC3
Gene ID:
Human(9014) Summary: Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. [provided by RefSeq, Jul 2008]
Mouse(21340) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B
Rat(690450) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B
cow(511236) TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
sheep(101102803) TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
naked mole-rat(101701724) TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
Zebrafish(449647) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B
domestic cat(101095736) TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
dog(100684854) TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
chicken(421933) TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005680 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005680 Rosetta Predictions human pricing
XM_001074480 Rosetta Predictions rat pricing
NM_020614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218731 predicted 879
2 SASI_Hs02_00340070 predicted 1228
3 SASI_Hs01_00218733 predicted 1059
4 SASI_Hs01_00218734 predicted 1171
5 SASI_Hs01_00218735 predicted 675
6 SASI_Hs01_00218736 predicted 1760
7 SASI_Hs01_00218738 predicted 1180
8 SASI_Hs01_00218739 predicted 1109
9 SASI_Hs01_00218740 predicted 1160
10 SASI_Hs02_00340071 predicted 735
11 SASI_Hs01_00218732 predicted 639
12 SASI_Hs01_00218737 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346394 predicted 803
2 SASI_Rn02_00346395 predicted 1014
3 SASI_Rn02_00346396 predicted 1561
4 SASI_Rn02_00346397 predicted 988
5 SASI_Rn02_00346398 predicted 1599
6 SASI_Rn02_00346399 predicted 1168
7 SASI_Rn02_00346400 predicted 281
8 SASI_Rn02_00346401 predicted 379
9 SASI_Rn02_00346402 predicted 297
10 SASI_Rn02_00346403 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061586 predicted 704
2 SASI_Mm01_00061587 predicted 930
3 SASI_Mm01_00061589 predicted 1006
4 SASI_Mm02_00325729 predicted 242
5 SASI_Mm01_00061590 predicted 385
6 SASI_Mm01_00061591 predicted 1133
7 SASI_Mm01_00061592 predicted 1444
8 SASI_Mm01_00061593 predicted 827
9 SASI_Mm01_00061594 predicted 1370
10 SASI_Mm01_00061595 predicted 805
11 SASI_Mm01_00061588 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005680
VALIDATED
TAF1B MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-494s21c1
Sequence:CCGGCCTACGGTATTAGAAGATAATCTCGAGATTATCTTCTAATACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-368s21c1
Sequence:CCGGGCCTTAAAGAACCTTGGAGTACTCGAGTACTCCAAGGTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005680.2-201s21c1
Sequence:CCGGGCCACAATGTTACAGAGAGATCTCGAGATCTCTCTGTAACATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-2034s21c1
Sequence:CCGGGCAGGTGAGCTTCATTTGATTCTCGAGAATCAAATGAAGCTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005680.1-2032s1c1
Sequence:CCGGGCAGGTGAGCTTCATTTGATTCTCGAGAATCAAATGAAGCTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-199s1c1
Sequence:CCGGGCCACAATGTTACAGAGAGATCTCGAGATCTCTCTGTAACATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-492s1c1
Sequence:CCGGCCTACGGTATTAGAAGATAATCTCGAGATTATCTTCTAATACCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-366s1c1
Sequence:CCGGGCCTTAAAGAACCTTGGAGTACTCGAGTACTCCAAGGTTCTTTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-1008s1c1
Sequence:CCGGCCCAACATACTGTGTATGAAACTCGAGTTTCATACACAGTATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005680
VALIDATED
TAF1B MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-494s21c1
Sequence:CCGGCCTACGGTATTAGAAGATAATCTCGAGATTATCTTCTAATACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-368s21c1
Sequence:CCGGGCCTTAAAGAACCTTGGAGTACTCGAGTACTCCAAGGTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005680.2-201s21c1
Sequence:CCGGGCCACAATGTTACAGAGAGATCTCGAGATCTCTCTGTAACATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-2034s21c1
Sequence:CCGGGCAGGTGAGCTTCATTTGATTCTCGAGAATCAAATGAAGCTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005680.1-2032s1c1
Sequence:CCGGGCAGGTGAGCTTCATTTGATTCTCGAGAATCAAATGAAGCTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-199s1c1
Sequence:CCGGGCCACAATGTTACAGAGAGATCTCGAGATCTCTCTGTAACATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-492s1c1
Sequence:CCGGCCTACGGTATTAGAAGATAATCTCGAGATTATCTTCTAATACCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-366s1c1
Sequence:CCGGGCCTTAAAGAACCTTGGAGTACTCGAGTACTCCAAGGTTCTTTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-1008s1c1
Sequence:CCGGCCCAACATACTGTGTATGAAACTCGAGTTTCATACACAGTATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005680
VALIDATED
TAF1B MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-494s21c1
Sequence:CCGGCCTACGGTATTAGAAGATAATCTCGAGATTATCTTCTAATACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-368s21c1
Sequence:CCGGGCCTTAAAGAACCTTGGAGTACTCGAGTACTCCAAGGTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005680.2-201s21c1
Sequence:CCGGGCCACAATGTTACAGAGAGATCTCGAGATCTCTCTGTAACATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005680.2-2034s21c1
Sequence:CCGGGCAGGTGAGCTTCATTTGATTCTCGAGAATCAAATGAAGCTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005680.1-2032s1c1
Sequence:CCGGGCAGGTGAGCTTCATTTGATTCTCGAGAATCAAATGAAGCTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-199s1c1
Sequence:CCGGGCCACAATGTTACAGAGAGATCTCGAGATCTCTCTGTAACATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-492s1c1
Sequence:CCGGCCTACGGTATTAGAAGATAATCTCGAGATTATCTTCTAATACCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-366s1c1
Sequence:CCGGGCCTTAAAGAACCTTGGAGTACTCGAGTACTCCAAGGTTCTTTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005680.1-1008s1c1
Sequence:CCGGCCCAACATACTGTGTATGAAACTCGAGTTTCATACACAGTATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020614
VALIDATED
TAF1B MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-964s21c1
Sequence:GTACCGGTTAACCTGTCAAGTAGTAAAGCTCGAGCTTTACTACTTGACAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-1015s21c1
Sequence:GTACCGGACGTTTGATCCTATAGCTAAACTCGAGTTTAGCTATAGGATCAAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-713s21c1
Sequence:CCGGAGGATCATATTCCGTACATAACTCGAGTTATGTACGGAATATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-1308s21c1
Sequence:CCGGCGATAAGTCCGTCGCATATAACTCGAGTTATATGCGACGGACTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-811s21c1
Sequence:CCGGGACTATGAAGACATCTATAAACTCGAGTTTATAGATGTCTTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-245s1c1
Sequence:CCGGGCATACTTTATCACCAAGCAACTCGAGTTGCTTGGTGATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020614.1-434s1c1
Sequence:CCGGGCAGTGATCTTGAGCTGCTAACTCGAGTTAGCAGCTCAAGATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-946s1c1
Sequence:CCGGCCTGATGAAATGCACACTTTACTCGAGTAAAGTGTGCATTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-1317s1c1
Sequence:CCGGCGTCGCATATAAGAGAAGAAACTCGAGTTTCTTCTCTTATATGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-246s1c1
Sequence:CCGGCATACTTTATCACCAAGCAAACTCGAGTTTGCTTGGTGATAAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020614
VALIDATED
TAF1B MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-964s21c1
Sequence:GTACCGGTTAACCTGTCAAGTAGTAAAGCTCGAGCTTTACTACTTGACAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-1015s21c1
Sequence:GTACCGGACGTTTGATCCTATAGCTAAACTCGAGTTTAGCTATAGGATCAAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-713s21c1
Sequence:CCGGAGGATCATATTCCGTACATAACTCGAGTTATGTACGGAATATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-1308s21c1
Sequence:CCGGCGATAAGTCCGTCGCATATAACTCGAGTTATATGCGACGGACTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-811s21c1
Sequence:CCGGGACTATGAAGACATCTATAAACTCGAGTTTATAGATGTCTTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-245s1c1
Sequence:CCGGGCATACTTTATCACCAAGCAACTCGAGTTGCTTGGTGATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020614.1-434s1c1
Sequence:CCGGGCAGTGATCTTGAGCTGCTAACTCGAGTTAGCAGCTCAAGATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-946s1c1
Sequence:CCGGCCTGATGAAATGCACACTTTACTCGAGTAAAGTGTGCATTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-1317s1c1
Sequence:CCGGCGTCGCATATAAGAGAAGAAACTCGAGTTTCTTCTCTTATATGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-246s1c1
Sequence:CCGGCATACTTTATCACCAAGCAAACTCGAGTTTGCTTGGTGATAAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020614
VALIDATED
TAF1B MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-964s21c1
Sequence:GTACCGGTTAACCTGTCAAGTAGTAAAGCTCGAGCTTTACTACTTGACAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-1015s21c1
Sequence:GTACCGGACGTTTGATCCTATAGCTAAACTCGAGTTTAGCTATAGGATCAAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-713s21c1
Sequence:CCGGAGGATCATATTCCGTACATAACTCGAGTTATGTACGGAATATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-1308s21c1
Sequence:CCGGCGATAAGTCCGTCGCATATAACTCGAGTTATATGCGACGGACTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020614.1-811s21c1
Sequence:CCGGGACTATGAAGACATCTATAAACTCGAGTTTATAGATGTCTTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-245s1c1
Sequence:CCGGGCATACTTTATCACCAAGCAACTCGAGTTGCTTGGTGATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020614.1-434s1c1
Sequence:CCGGGCAGTGATCTTGAGCTGCTAACTCGAGTTAGCAGCTCAAGATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-946s1c1
Sequence:CCGGCCTGATGAAATGCACACTTTACTCGAGTAAAGTGTGCATTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-1317s1c1
Sequence:CCGGCGTCGCATATAAGAGAAGAAACTCGAGTTTCTTCTCTTATATGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020614.1-246s1c1
Sequence:CCGGCATACTTTATCACCAAGCAAACTCGAGTTTGCTTGGTGATAAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks