EMAIL THIS PAGE TO A FRIEND

TAF1C

TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa

Synonyms: MGC:39976 SL1 TAFI110 TAFI95
Gene ID:
Human(9013) Summary: Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Mouse(21341) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C
Rat(361420) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C
chicken(772287) TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
dog(609622) TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
cow(509238) TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
sheep(101123064) TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005679 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068301 MISSION® esiRNA esiRNA targeting mouse Taf1c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005679 Rosetta Predictions human pricing
NM_139353 Rosetta Predictions human pricing
NM_001014155 Rosetta Predictions rat pricing
NM_021441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023390 predicted 2895
2 SASI_Hs01_00023391 predicted 2972
3 SASI_Hs01_00023392 predicted 2775
4 SASI_Hs01_00023393 predicted 1377
5 SASI_Hs01_00023394 predicted 660
6 SASI_Hs01_00023395 predicted 3042
7 SASI_Hs01_00023396 predicted 3283
8 SASI_Hs01_00023397 predicted 1362
9 SASI_Hs01_00023398 predicted 1446
10 SASI_Hs01_00023399 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170283 predicted 2653
2 SASI_Hs01_00170284 predicted 2727
3 SASI_Hs01_00170285 predicted 2532
4 SASI_Hs01_00170286 predicted 1134
5 SASI_Hs01_00170287 predicted 495
6 SASI_Hs01_00170288 predicted 2793
7 SASI_Hs01_00170289 predicted 3043
8 SASI_Hs01_00170290 predicted 1124
9 SASI_Hs01_00170291 predicted 1204
10 SASI_Hs01_00170292 predicted 1808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032927 predicted 1365
2 SASI_Rn01_00032928 predicted 596
3 SASI_Rn01_00032929 predicted 2517
4 SASI_Rn01_00032931 predicted 2321
5 SASI_Rn01_00032932 predicted 323
6 SASI_Rn01_00032933 predicted 1092
7 SASI_Rn01_00032934 predicted 1004
8 SASI_Rn01_00032935 predicted 1357
9 SASI_Rn02_00201640 predicted 1790
10 SASI_Rn02_00201641 predicted 776
11 SASI_Rn01_00032930 predicted 208
12 SASI_Rn01_00032936 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119923 predicted 1575
2 SASI_Mm01_00119924 predicted 1415
3 SASI_Mm01_00119925 predicted 475
4 SASI_Mm01_00119926 predicted 2740
5 SASI_Mm01_00119927 predicted 810
6 SASI_Mm01_00119928 predicted 1825
7 SASI_Mm02_00326086 predicted 2213
8 SASI_Mm01_00119929 predicted 1923
9 SASI_Mm01_00119930 predicted 2249
10 SASI_Mm01_00119931 predicted 1874
11 SASI_Mm01_00119932 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005679
VALIDATED
TAF1C MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005679.2-3757s1c1
Sequence:CCGGCTGATGACATAGTAAGAGAAACTCGAGTTTCTCTTACTATGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005679.2-1058s1c1
Sequence:CCGGAGGGAGAAAGTAAGGCCCTTACTCGAGTAAGGGCCTTACTTTCTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-559s1c1
Sequence:CCGGCTCTTGGATCATGGAGACGTACTCGAGTACGTCTCCATGATCCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-1589s1c1
Sequence:CCGGCTACTCTTCATCTCGTCTGTACTCGAGTACAGACGAGATGAAGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-1177s1c1
Sequence:CCGGGCCGTGTGGAAGTTTGGTAAACTCGAGTTTACCAAACTTCCACACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-1450s21c1
Sequence:CCGGGTGAAGATGCTGGACACTCAGCTCGAGCTGAGTGTCCAGCATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-530s21c1
Sequence:CCGGTGGATGTGACTGAGCAGATCACTCGAGTGATCTGCTCAGTCACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-2664s21c1
Sequence:CCGGGCAGATGCTCCGTGACTACATCTCGAGATGTAGTCACGGAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-948s21c1
Sequence:CCGGGCATTTCCAAGAGGTCGTTCTCTCGAGAGAACGACCTCTTGGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-290s21c1
Sequence:CCGGACGTCCCTGACCTCTCTTTCACTCGAGTGAAAGAGAGGTCAGGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005679
VALIDATED
TAF1C MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005679.2-3757s1c1
Sequence:CCGGCTGATGACATAGTAAGAGAAACTCGAGTTTCTCTTACTATGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005679.2-1058s1c1
Sequence:CCGGAGGGAGAAAGTAAGGCCCTTACTCGAGTAAGGGCCTTACTTTCTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-559s1c1
Sequence:CCGGCTCTTGGATCATGGAGACGTACTCGAGTACGTCTCCATGATCCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-1589s1c1
Sequence:CCGGCTACTCTTCATCTCGTCTGTACTCGAGTACAGACGAGATGAAGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-1177s1c1
Sequence:CCGGGCCGTGTGGAAGTTTGGTAAACTCGAGTTTACCAAACTTCCACACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-1450s21c1
Sequence:CCGGGTGAAGATGCTGGACACTCAGCTCGAGCTGAGTGTCCAGCATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-530s21c1
Sequence:CCGGTGGATGTGACTGAGCAGATCACTCGAGTGATCTGCTCAGTCACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-2664s21c1
Sequence:CCGGGCAGATGCTCCGTGACTACATCTCGAGATGTAGTCACGGAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-948s21c1
Sequence:CCGGGCATTTCCAAGAGGTCGTTCTCTCGAGAGAACGACCTCTTGGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-290s21c1
Sequence:CCGGACGTCCCTGACCTCTCTTTCACTCGAGTGAAAGAGAGGTCAGGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005679
VALIDATED
TAF1C MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005679.2-3757s1c1
Sequence:CCGGCTGATGACATAGTAAGAGAAACTCGAGTTTCTCTTACTATGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005679.2-1058s1c1
Sequence:CCGGAGGGAGAAAGTAAGGCCCTTACTCGAGTAAGGGCCTTACTTTCTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-559s1c1
Sequence:CCGGCTCTTGGATCATGGAGACGTACTCGAGTACGTCTCCATGATCCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-1589s1c1
Sequence:CCGGCTACTCTTCATCTCGTCTGTACTCGAGTACAGACGAGATGAAGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005679.2-1177s1c1
Sequence:CCGGGCCGTGTGGAAGTTTGGTAAACTCGAGTTTACCAAACTTCCACACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-1450s21c1
Sequence:CCGGGTGAAGATGCTGGACACTCAGCTCGAGCTGAGTGTCCAGCATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-530s21c1
Sequence:CCGGTGGATGTGACTGAGCAGATCACTCGAGTGATCTGCTCAGTCACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-2664s21c1
Sequence:CCGGGCAGATGCTCCGTGACTACATCTCGAGATGTAGTCACGGAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-948s21c1
Sequence:CCGGGCATTTCCAAGAGGTCGTTCTCTCGAGAGAACGACCTCTTGGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005679.2-290s21c1
Sequence:CCGGACGTCCCTGACCTCTCTTTCACTCGAGTGAAAGAGAGGTCAGGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021441
VALIDATED
TAF1C MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021441.1-2913s1c1
Sequence:CCGGCGTGTATTTGATGGTAGGATACTCGAGTATCCTACCATCAAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021441.1-2394s1c1
Sequence:CCGGGACTCAGTTGTCTAGCACCTTCTCGAGAAGGTGCTAGACAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021441.1-786s1c1
Sequence:CCGGCAGGTCAGTGTCACTACTCATCTCGAGATGAGTAGTGACACTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021441.1-660s1c1
Sequence:CCGGGATGACTATAGTCAGCGCGAACTCGAGTTCGCGCTGACTATAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021441.1-1521s1c1
Sequence:CCGGGCATCTCATCTGCACCCAGTTCTCGAGAACTGGGTGCAGATGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021441.2-2267s21c1
Sequence:CCGGGACTCAGTTGTCTAGCACCTTCTCGAGAAGGTGCTAGACAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-980s21c1
Sequence:CCGGTGCCACGTGGAAGATTGATAACTCGAGTTATCAATCTTCCACGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-2734s21c1
Sequence:CCGGGAAACGTGAGCAGTGTAGAACCTCGAGGTTCTACACTGCTCACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-814s21c1
Sequence:CCGGGTGCCTTGGACAAGCTGTATTCTCGAGAATACAGCTTGTCCAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021441.2-2466s21c1
Sequence:CCGGACGGACAAGCTGCCACTTAAGCTCGAGCTTAAGTGGCAGCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021441
VALIDATED
TAF1C MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021441.1-2913s1c1
Sequence:CCGGCGTGTATTTGATGGTAGGATACTCGAGTATCCTACCATCAAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021441.1-2394s1c1
Sequence:CCGGGACTCAGTTGTCTAGCACCTTCTCGAGAAGGTGCTAGACAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021441.1-786s1c1
Sequence:CCGGCAGGTCAGTGTCACTACTCATCTCGAGATGAGTAGTGACACTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021441.1-660s1c1
Sequence:CCGGGATGACTATAGTCAGCGCGAACTCGAGTTCGCGCTGACTATAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021441.1-1521s1c1
Sequence:CCGGGCATCTCATCTGCACCCAGTTCTCGAGAACTGGGTGCAGATGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021441.2-2267s21c1
Sequence:CCGGGACTCAGTTGTCTAGCACCTTCTCGAGAAGGTGCTAGACAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-980s21c1
Sequence:CCGGTGCCACGTGGAAGATTGATAACTCGAGTTATCAATCTTCCACGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-2734s21c1
Sequence:CCGGGAAACGTGAGCAGTGTAGAACCTCGAGGTTCTACACTGCTCACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-814s21c1
Sequence:CCGGGTGCCTTGGACAAGCTGTATTCTCGAGAATACAGCTTGTCCAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021441.2-2466s21c1
Sequence:CCGGACGGACAAGCTGCCACTTAAGCTCGAGCTTAAGTGGCAGCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021441
VALIDATED
TAF1C MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021441.1-2913s1c1
Sequence:CCGGCGTGTATTTGATGGTAGGATACTCGAGTATCCTACCATCAAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021441.1-2394s1c1
Sequence:CCGGGACTCAGTTGTCTAGCACCTTCTCGAGAAGGTGCTAGACAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021441.1-786s1c1
Sequence:CCGGCAGGTCAGTGTCACTACTCATCTCGAGATGAGTAGTGACACTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021441.1-660s1c1
Sequence:CCGGGATGACTATAGTCAGCGCGAACTCGAGTTCGCGCTGACTATAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021441.1-1521s1c1
Sequence:CCGGGCATCTCATCTGCACCCAGTTCTCGAGAACTGGGTGCAGATGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021441.2-2267s21c1
Sequence:CCGGGACTCAGTTGTCTAGCACCTTCTCGAGAAGGTGCTAGACAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-980s21c1
Sequence:CCGGTGCCACGTGGAAGATTGATAACTCGAGTTATCAATCTTCCACGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-2734s21c1
Sequence:CCGGGAAACGTGAGCAGTGTAGAACCTCGAGGTTCTACACTGCTCACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021441.2-814s21c1
Sequence:CCGGGTGCCTTGGACAAGCTGTATTCTCGAGAATACAGCTTGTCCAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021441.2-2466s21c1
Sequence:CCGGACGGACAAGCTGCCACTTAAGCTCGAGCTTAAGTGGCAGCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks