EMAIL THIS PAGE TO A FRIEND

TAF1D

TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa

Synonyms: JOSD3 RAFI41 TAF(I)41 TAFI41
UniProtKB ID: Q9H5J8, Q6I9Y6
Gene ID:
Human(79101) Summary: TAF1D is a member of the SL1 complex, which includes TBP (MIM 600075) and TAF1A (MIM 604903), TAF1B (MIM 604904), and TAF1C (MIM 604905), and plays a role in RNA polymerase I transcription (Wang et al., 2004 [PubMed 15520167]
Mouse(75316) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, D
Rat(363017) TATA box binding protein (Tbp)-associated factor, RNA polymerase I, D
cow(505533) TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
sheep(101119170) TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
domestic guinea pig(100722432) TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
naked mole-rat(101701427) TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
chicken(419002) TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
dog(476770) TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
domestic cat(101082939) TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0056 AQUA Peptide ILTFEQAVA[R] cow, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024116 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069781 MISSION® esiRNA esiRNA human TAF1D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024116 Rosetta Predictions human pricing
NM_001014207 Rosetta Predictions rat pricing
NM_027261 Rosetta Predictions mouse pricing
NM_029248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119698 predicted 230
2 SASI_Hs01_00119700 predicted 201
3 SASI_Hs01_00119701 predicted 924
4 SASI_Hs01_00119702 predicted 846
5 SASI_Hs01_00119703 predicted 841
6 SASI_Hs02_00356609 predicted 919
7 SASI_Hs01_00119705 predicted 891
8 SASI_Hs01_00119706 predicted 740
9 SASI_Hs01_00119707 predicted 855
10 SASI_Hs02_00356610 predicted 920
11 SASI_Hs01_00119699 predicted 704
12 SASI_Hs01_00119704 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100173 predicted 707
2 SASI_Rn01_00100174 predicted 663
3 SASI_Rn01_00100175 predicted 705
4 SASI_Rn02_00201734 predicted 853
5 SASI_Rn01_00100176 predicted 684
6 SASI_Rn01_00100177 predicted 743
7 SASI_Rn01_00100178 predicted 613
8 SASI_Rn01_00100179 predicted 597
9 SASI_Rn02_00201735 predicted 529
10 SASI_Rn02_00201736 predicted 699
11 SASI_Rn01_00100172 predicted 867
12 SASI_Rn01_00100180 predicted 526
13 SASI_Rn01_00100181 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094422 predicted 636
2 SASI_Mm01_00094423 predicted 552
3 SASI_Mm01_00094424 predicted 617
4 SASI_Mm01_00094425 predicted 618
5 SASI_Mm01_00094426 predicted 613
6 SASI_Mm01_00094427 predicted 552
7 SASI_Mm01_00094429 predicted 640
8 SASI_Mm01_00094430 predicted 640
9 SASI_Mm02_00331841 predicted 613
10 SASI_Mm01_00094431 predicted 542
11 SASI_Mm01_00094428 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068684 predicted 644
2 SASI_Mm01_00068685 predicted 558
3 SASI_Mm01_00068686 predicted 622
4 SASI_Mm01_00068687 predicted 618
5 SASI_Mm01_00068688 predicted 616
6 SASI_Mm01_00068689 predicted 557
7 SASI_Mm01_00068691 predicted 643
8 SASI_Mm01_00068692 predicted 634
9 SASI_Mm02_00335022 predicted 610
10 SASI_Mm01_00068693 predicted 552
11 SASI_Mm01_00068690 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029248
VALIDATED
TAF1D MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-622s21c1
Sequence:CCGGTTGACAGTCGGAGGCACAAATCTCGAGATTTGTGCCTCCGACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-255s21c1
Sequence:CCGGGAACCAAGGCCTCTGACTTTACTCGAGTAAAGTCAGAGGCCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-127s21c1
Sequence:CCGGCCTCTGATGGCAGCTTATTTACTCGAGTAAATAAGCTGCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-879s1c1
Sequence:CCGGGGAAATGAACATGTGACTATTCTCGAGAATAGTCACATGTTCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-127s1c1
Sequence:CCGGCCTCTGATGGCAGCTTATTTACTCGAGTAAATAAGCTGCCATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029248.1-188s21c1
Sequence:CCGGCCCTACTGTGAAACGTGTTACCTCGAGGTAACACGTTTCACAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-667s21c1
Sequence:CCGGCTCCTATTGAAGAGCCATTAACTCGAGTTAATGGCTCTTCAATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-667s1c1
Sequence:CCGGCTCCTATTGAAGAGCCATTAACTCGAGTTAATGGCTCTTCAATAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-397s1c1
Sequence:CCGGGAAGGTCGCAAATAGATGCAACTCGAGTTGCATCTATTTGCGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029248
VALIDATED
TAF1D MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-622s21c1
Sequence:CCGGTTGACAGTCGGAGGCACAAATCTCGAGATTTGTGCCTCCGACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-255s21c1
Sequence:CCGGGAACCAAGGCCTCTGACTTTACTCGAGTAAAGTCAGAGGCCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-127s21c1
Sequence:CCGGCCTCTGATGGCAGCTTATTTACTCGAGTAAATAAGCTGCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-879s1c1
Sequence:CCGGGGAAATGAACATGTGACTATTCTCGAGAATAGTCACATGTTCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-127s1c1
Sequence:CCGGCCTCTGATGGCAGCTTATTTACTCGAGTAAATAAGCTGCCATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029248.1-188s21c1
Sequence:CCGGCCCTACTGTGAAACGTGTTACCTCGAGGTAACACGTTTCACAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-667s21c1
Sequence:CCGGCTCCTATTGAAGAGCCATTAACTCGAGTTAATGGCTCTTCAATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-667s1c1
Sequence:CCGGCTCCTATTGAAGAGCCATTAACTCGAGTTAATGGCTCTTCAATAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-397s1c1
Sequence:CCGGGAAGGTCGCAAATAGATGCAACTCGAGTTGCATCTATTTGCGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029248
VALIDATED
TAF1D MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-622s21c1
Sequence:CCGGTTGACAGTCGGAGGCACAAATCTCGAGATTTGTGCCTCCGACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-255s21c1
Sequence:CCGGGAACCAAGGCCTCTGACTTTACTCGAGTAAAGTCAGAGGCCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-127s21c1
Sequence:CCGGCCTCTGATGGCAGCTTATTTACTCGAGTAAATAAGCTGCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-879s1c1
Sequence:CCGGGGAAATGAACATGTGACTATTCTCGAGAATAGTCACATGTTCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-127s1c1
Sequence:CCGGCCTCTGATGGCAGCTTATTTACTCGAGTAAATAAGCTGCCATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029248.1-188s21c1
Sequence:CCGGCCCTACTGTGAAACGTGTTACCTCGAGGTAACACGTTTCACAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029248.1-667s21c1
Sequence:CCGGCTCCTATTGAAGAGCCATTAACTCGAGTTAATGGCTCTTCAATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-667s1c1
Sequence:CCGGCTCCTATTGAAGAGCCATTAACTCGAGTTAATGGCTCTTCAATAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029248.1-397s1c1
Sequence:CCGGGAAGGTCGCAAATAGATGCAACTCGAGTTGCATCTATTTGCGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024116
VALIDATED
TAF1D MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-279s21c1
Sequence:GTACCGGCTTCTGATAGCAGCTTATTTACTCGAGTAAATAAGCTGCTATCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-1052s21c1
Sequence:CCGGTGTCAAAGGTGAAGCATATAGCTCGAGCTATATGCTTCACCTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-945s21c1
Sequence:CCGGACTTAGAAGAAGAGGATATTACTCGAGTAATATCCTCTTCTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-774s21c1
Sequence:CCGGTTGACAGTCGTAGATACAAATCTCGAGATTTGTATCTACGACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-413s21c1
Sequence:CCGGGAACCAATACCATTGACTATACTCGAGTATAGTCAATGGTATTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-846s1c1
Sequence:CCGGGAGGATGAGGATGCAACACATCTCGAGATGTGTTGCATCCTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-258s1c1
Sequence:CCGGGAACTTGCAAATCGAAGTGATCTCGAGATCACTTCGATTTGCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-270s1c1
Sequence:CCGGCGAAGTGATAACTCTTCTGATCTCGAGATCAGAAGAGTTATCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-391s1c1
Sequence:CCGGGTGATTCATCAAGTGACTCATCTCGAGATGAGTCACTTGATGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-253s1c1
Sequence:CCGGCTGTGGAACTTGCAAATCGAACTCGAGTTCGATTTGCAAGTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-722s1c1
Sequence:CCGGCCTGAAAGAATCATTGAAGCACTCGAGTGCTTCAATGATTCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024116.1-1141s1c1
Sequence:CCGGCGCTTAGGAATGAATGTGATTCTCGAGAATCACATTCATTCCTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-375s1c1
Sequence:CCGGGAAAGTGTTCACGCAAGTGATCTCGAGATCACTTGCGTGAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024116
VALIDATED
TAF1D MISSION shRNA shRNA Plasmid DNA
TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-279s21c1
Sequence:GTACCGGCTTCTGATAGCAGCTTATTTACTCGAGTAAATAAGCTGCTATCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-1052s21c1
Sequence:CCGGTGTCAAAGGTGAAGCATATAGCTCGAGCTATATGCTTCACCTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-945s21c1
Sequence:CCGGACTTAGAAGAAGAGGATATTACTCGAGTAATATCCTCTTCTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-774s21c1
Sequence:CCGGTTGACAGTCGTAGATACAAATCTCGAGATTTGTATCTACGACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-413s21c1
Sequence:CCGGGAACCAATACCATTGACTATACTCGAGTATAGTCAATGGTATTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-846s1c1
Sequence:CCGGGAGGATGAGGATGCAACACATCTCGAGATGTGTTGCATCCTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-258s1c1
Sequence:CCGGGAACTTGCAAATCGAAGTGATCTCGAGATCACTTCGATTTGCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-270s1c1
Sequence:CCGGCGAAGTGATAACTCTTCTGATCTCGAGATCAGAAGAGTTATCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-391s1c1
Sequence:CCGGGTGATTCATCAAGTGACTCATCTCGAGATGAGTCACTTGATGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-253s1c1
Sequence:CCGGCTGTGGAACTTGCAAATCGAACTCGAGTTCGATTTGCAAGTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-722s1c1
Sequence:CCGGCCTGAAAGAATCATTGAAGCACTCGAGTGCTTCAATGATTCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024116.1-1141s1c1
Sequence:CCGGCGCTTAGGAATGAATGTGATTCTCGAGAATCACATTCATTCCTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-375s1c1
Sequence:CCGGGAAAGTGTTCACGCAAGTGATCTCGAGATCACTTGCGTGAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024116
VALIDATED
TAF1D MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-279s21c1
Sequence:GTACCGGCTTCTGATAGCAGCTTATTTACTCGAGTAAATAAGCTGCTATCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-1052s21c1
Sequence:CCGGTGTCAAAGGTGAAGCATATAGCTCGAGCTATATGCTTCACCTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-945s21c1
Sequence:CCGGACTTAGAAGAAGAGGATATTACTCGAGTAATATCCTCTTCTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-774s21c1
Sequence:CCGGTTGACAGTCGTAGATACAAATCTCGAGATTTGTATCTACGACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024116.2-413s21c1
Sequence:CCGGGAACCAATACCATTGACTATACTCGAGTATAGTCAATGGTATTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-846s1c1
Sequence:CCGGGAGGATGAGGATGCAACACATCTCGAGATGTGTTGCATCCTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-258s1c1
Sequence:CCGGGAACTTGCAAATCGAAGTGATCTCGAGATCACTTCGATTTGCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-270s1c1
Sequence:CCGGCGAAGTGATAACTCTTCTGATCTCGAGATCAGAAGAGTTATCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-391s1c1
Sequence:CCGGGTGATTCATCAAGTGACTCATCTCGAGATGAGTCACTTGATGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-253s1c1
Sequence:CCGGCTGTGGAACTTGCAAATCGAACTCGAGTTCGATTTGCAAGTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024116.1-722s1c1
Sequence:CCGGCCTGAAAGAATCATTGAAGCACTCGAGTGCTTCAATGATTCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024116.1-1141s1c1
Sequence:CCGGCGCTTAGGAATGAATGTGATTCTCGAGAATCACATTCATTCCTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024116.1-375s1c1
Sequence:CCGGGAAAGTGTTCACGCAAGTGATCTCGAGATCACTTGCGTGAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks