EMAIL THIS PAGE TO A FRIEND

TAF1L

TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like

Synonyms: TAF2A2
Species: Human TAF1L(138474)
UniProtKB ID: Q8IZX4, Q0VG57
Gene ID:
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0046 AQUA Peptide TPQDLTG[K] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153809 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044934 predicted 680
2 SASI_Hs01_00044935 predicted 2356
3 SASI_Hs01_00044936 predicted 4938
4 SASI_Hs01_00044937 predicted 688
5 SASI_Hs01_00044939 predicted 603
6 SASI_Hs01_00044940 predicted 602
7 SASI_Hs01_00044941 predicted 586
8 SASI_Hs02_00367482 predicted 589
9 SASI_Hs01_00044938 predicted 4947
10 SASI_Hs02_00367483 predicted 4009
11 SASI_Hs01_00044942 predicted 5519
12 SASI_Hs01_00044943 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153809
VALIDATED
TAF1L MISSION shRNA Bacterial Glycerol Stock
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4231s1c1
Sequence:CCGGCCACTGTTCATTGTGACTATTCTCGAGAATAGTCACAATGAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-1919s1c1
Sequence:CCGGCCAGCATTCAATTCCTGCTATCTCGAGATAGCAGGAATTGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-1464s1c1
Sequence:CCGGCCTTCTATTAAGACTAGGAATCTCGAGATTCCTAGTCTTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-194s1c1
Sequence:CCGGCCCATTTACTTTAGCGGGTATCTCGAGATACCCGCTAAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4791s1c1
Sequence:CCGGCCAGTGGATTTAGAGACCATACTCGAGTATGGTCTCTAAATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4881s1c1
Sequence:CCGGGCCAACAGTGTTAAGTATAATCTCGAGATTATACTTAACACTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-5375s1c1
Sequence:CCGGGTATGAGGATTTGCTTATATCCTCGAGGATATAAGCAAATCCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153809.1-5819s1c1
Sequence:CCGGCGAAACTTCATCTCTACTAAACTCGAGTTTAGTAGAGATGAAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-3160s1c1
Sequence:CCGGCCAAGCAACTTCTACGTAAATCTCGAGATTTACGTAGAAGTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153809.1-2461s1c1
Sequence:CCGGGTTACTATATTCGGGAATTAGCTCGAGCTAATTCCCGAATATAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-3489s21c1
Sequence:GTACCGGCTCTCAGCTGTCACGTGAATGCTCGAGCATTCACGTGACAGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-1459s21c1
Sequence:CCGGCCTTCTATTAAGACTAGGAATCTCGAGATTCCTAGTCTTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153809.2-5692s21c1
Sequence:CCGGCTTCAGCAGCATCGGAAATTTCTCGAGAAATTTCCGATGCTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-4876s21c1
Sequence:CCGGGCCAACAGTGTTAAGTATAATCTCGAGATTATACTTAACACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-5370s21c1
Sequence:CCGGGTATGAGGATTTGCTTATATCCTCGAGGATATAAGCAAATCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-2456s21c1
Sequence:CCGGGTTACTATATTCGGGAATTAGCTCGAGCTAATTCCCGAATATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153809
VALIDATED
TAF1L MISSION shRNA shRNA Plasmid DNA
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4231s1c1
Sequence:CCGGCCACTGTTCATTGTGACTATTCTCGAGAATAGTCACAATGAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-1919s1c1
Sequence:CCGGCCAGCATTCAATTCCTGCTATCTCGAGATAGCAGGAATTGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-1464s1c1
Sequence:CCGGCCTTCTATTAAGACTAGGAATCTCGAGATTCCTAGTCTTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-194s1c1
Sequence:CCGGCCCATTTACTTTAGCGGGTATCTCGAGATACCCGCTAAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4791s1c1
Sequence:CCGGCCAGTGGATTTAGAGACCATACTCGAGTATGGTCTCTAAATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4881s1c1
Sequence:CCGGGCCAACAGTGTTAAGTATAATCTCGAGATTATACTTAACACTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-5375s1c1
Sequence:CCGGGTATGAGGATTTGCTTATATCCTCGAGGATATAAGCAAATCCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153809.1-5819s1c1
Sequence:CCGGCGAAACTTCATCTCTACTAAACTCGAGTTTAGTAGAGATGAAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-3160s1c1
Sequence:CCGGCCAAGCAACTTCTACGTAAATCTCGAGATTTACGTAGAAGTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153809.1-2461s1c1
Sequence:CCGGGTTACTATATTCGGGAATTAGCTCGAGCTAATTCCCGAATATAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-3489s21c1
Sequence:GTACCGGCTCTCAGCTGTCACGTGAATGCTCGAGCATTCACGTGACAGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-1459s21c1
Sequence:CCGGCCTTCTATTAAGACTAGGAATCTCGAGATTCCTAGTCTTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153809.2-5692s21c1
Sequence:CCGGCTTCAGCAGCATCGGAAATTTCTCGAGAAATTTCCGATGCTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-4876s21c1
Sequence:CCGGGCCAACAGTGTTAAGTATAATCTCGAGATTATACTTAACACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-5370s21c1
Sequence:CCGGGTATGAGGATTTGCTTATATCCTCGAGGATATAAGCAAATCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-2456s21c1
Sequence:CCGGGTTACTATATTCGGGAATTAGCTCGAGCTAATTCCCGAATATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153809
VALIDATED
TAF1L MISSION shRNA Lentiviral Transduction Particles
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4231s1c1
Sequence:CCGGCCACTGTTCATTGTGACTATTCTCGAGAATAGTCACAATGAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-1919s1c1
Sequence:CCGGCCAGCATTCAATTCCTGCTATCTCGAGATAGCAGGAATTGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-1464s1c1
Sequence:CCGGCCTTCTATTAAGACTAGGAATCTCGAGATTCCTAGTCTTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-194s1c1
Sequence:CCGGCCCATTTACTTTAGCGGGTATCTCGAGATACCCGCTAAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4791s1c1
Sequence:CCGGCCAGTGGATTTAGAGACCATACTCGAGTATGGTCTCTAAATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-4881s1c1
Sequence:CCGGGCCAACAGTGTTAAGTATAATCTCGAGATTATACTTAACACTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-5375s1c1
Sequence:CCGGGTATGAGGATTTGCTTATATCCTCGAGGATATAAGCAAATCCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153809.1-5819s1c1
Sequence:CCGGCGAAACTTCATCTCTACTAAACTCGAGTTTAGTAGAGATGAAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153809.1-3160s1c1
Sequence:CCGGCCAAGCAACTTCTACGTAAATCTCGAGATTTACGTAGAAGTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153809.1-2461s1c1
Sequence:CCGGGTTACTATATTCGGGAATTAGCTCGAGCTAATTCCCGAATATAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-3489s21c1
Sequence:GTACCGGCTCTCAGCTGTCACGTGAATGCTCGAGCATTCACGTGACAGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-1459s21c1
Sequence:CCGGCCTTCTATTAAGACTAGGAATCTCGAGATTCCTAGTCTTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153809.2-5692s21c1
Sequence:CCGGCTTCAGCAGCATCGGAAATTTCTCGAGAAATTTCCGATGCTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-4876s21c1
Sequence:CCGGGCCAACAGTGTTAAGTATAATCTCGAGATTATACTTAACACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-5370s21c1
Sequence:CCGGGTATGAGGATTTGCTTATATCCTCGAGGATATAAGCAAATCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153809.2-2456s21c1
Sequence:CCGGGTTACTATATTCGGGAATTAGCTCGAGCTAATTCCCGAATATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks