EMAIL THIS PAGE TO A FRIEND

TAF2

TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa

Synonyms: CIF150 TAF2B TAFII150
Gene ID:
Human(6873) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Mouse(319944) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(170844) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor
fruit fly(39164) TBP-associated factor 2
chicken(428389) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Horse(100057143) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
domestic cat(101098194) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
dog(475084) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Zebrafish(324486) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Thale Cress(843733) TBP-associated factor 2
naked mole-rat(101712975) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Domestic Rabbit(100353006) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
domestic guinea pig(100722226) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
cow(781912) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
sheep(101116155) TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102363 Anti-TAF2 antibody produced in rabbit affinity isolated antibody canine, zebrafish, guinea pig, horse, human, mouse, rat, rabbit
western blot pricing
SAB1305444 ANTI-TAF2(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0115 AQUA Peptide FPTPAS[R] chicken, dog, human, mouse, rat pricing
AQ0052 AQUA Peptide TLDNLNPDV[R] chicken, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003184 Rosetta Predictions human pricing
XM_001066741 Rosetta Predictions rat pricing
XM_343241 Rosetta Predictions rat pricing
NM_001081288 Rosetta Predictions mouse pricing
XM_885934 Rosetta Predictions mouse pricing
XM_896503 Rosetta Predictions mouse pricing
XM_896520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178985 predicted 3013
2 SASI_Hs01_00178986 predicted 334
3 SASI_Hs01_00178987 predicted 2911
4 SASI_Hs01_00178989 predicted 977
5 SASI_Hs01_00178990 predicted 1694
6 SASI_Hs01_00178991 predicted 2809
7 SASI_Hs01_00178992 predicted 1422
8 SASI_Hs01_00178993 predicted 3580
9 SASI_Hs02_00335213 predicted 1191
10 SASI_Hs02_00335214 predicted 1044
11 SASI_Hs01_00178988 predicted 3192
12 SASI_Hs01_00178994 predicted 2908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318592 predicted 388
2 SASI_Rn02_00318593 predicted 2749
3 SASI_Rn02_00318594 predicted 2420
4 SASI_Rn02_00318595 predicted 2097
5 SASI_Rn02_00318596 predicted 2839
6 SASI_Rn02_00318597 predicted 1393
7 SASI_Rn02_00318598 predicted 1543
8 SASI_Rn02_00318599 predicted 2173
9 SASI_Rn02_00318600 predicted 878
10 SASI_Rn02_00318601 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395523 predicted 394
2 SASI_Rn02_00395524 predicted 2749
3 SASI_Rn02_00395525 predicted 2417
4 SASI_Rn02_00395526 predicted 2090
5 SASI_Rn02_00395527 predicted 2845
6 SASI_Rn02_00395528 predicted 1388
7 SASI_Rn02_00395529 predicted 1543
8 SASI_Rn02_00395530 predicted 2172
9 SASI_Rn02_00395531 predicted 876
10 SASI_Rn02_00395532 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297001 predicted 401
2 SASI_Mm02_00297002 predicted 1619
3 SASI_Mm02_00297003 predicted 2135
4 SASI_Mm02_00297004 predicted 1579
5 SASI_Mm02_00297005 predicted 1143
6 SASI_Mm02_00297006 predicted 1709
7 SASI_Mm02_00297007 predicted 826
8 SASI_Mm02_00297008 predicted 2426
9 SASI_Mm02_00297009 predicted 871
10 SASI_Mm02_00297010 predicted 1987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262582 predicted 411
2 SASI_Mm01_00262583 predicted 1900
3 SASI_Mm01_00262584 predicted 1620
4 SASI_Mm01_00262585 predicted 3226
5 SASI_Mm01_00262586 predicted 1933
6 SASI_Mm01_00262587 predicted 363
7 SASI_Mm01_00262588 predicted 1145
8 SASI_Mm01_00262589 predicted 831
9 SASI_Mm01_00262590 predicted 2434
10 SASI_Mm01_00262591 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207159 predicted 569
2 SASI_Mm01_00207160 predicted 379
3 SASI_Mm01_00207161 predicted 235
4 SASI_Mm01_00207162 predicted 622
5 SASI_Mm01_00207163 predicted 530
6 SASI_Mm01_00207164 predicted 788
7 SASI_Mm01_00207165 predicted 575
8 SASI_Mm01_00207166 predicted 489
9 SASI_Mm01_00207167 predicted 424
10 SASI_Mm01_00207168 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230530 predicted 1289
2 SASI_Mm01_00230531 predicted 1316
3 SASI_Mm01_00230532 predicted 1261
4 SASI_Mm01_00230533 predicted 603
5 SASI_Mm01_00230534 predicted 640
6 SASI_Mm01_00230535 predicted 1245
7 SASI_Mm01_00230536 predicted 1308
8 SASI_Mm01_00230537 predicted 1208
9 SASI_Mm01_00230538 predicted 960
10 SASI_Mm01_00230539 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003184
VALIDATED
TAF2 MISSION shRNA Bacterial Glycerol Stock
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003184.3-4188s21c1
Sequence:CCGGGTACCGCCAAAGTCAATTATGCTCGAGCATAATTGACTTTGGCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-3028s21c1
Sequence:CCGGCCCTATGTAAGGCATAAGATTCTCGAGAATCTTATGCCTTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003184.3-331s21c1
Sequence:CCGGGAAAGCCCAAGGCCATATAAACTCGAGTTTATATGGCCTTGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-366s21c1
Sequence:CCGGCGTCTGCATCAACAACATAAACTCGAGTTTATGTTGTTGATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-3317s21c1
Sequence:CCGGGCAACCAAGAAGCTGCAAATACTCGAGTATTTGCAGCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3317s1c1
Sequence:CCGGGCAACCAAGAAGCTGCAAATACTCGAGTATTTGCAGCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3028s1c1
Sequence:CCGGCCCTATGTAAGGCATAAGATTCTCGAGAATCTTATGCCTTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-366s1c1
Sequence:CCGGCGTCTGCATCAACAACATAAACTCGAGTTTATGTTGTTGATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-1805s1c1
Sequence:CCGGGCAAAGATATTCAGCCGTTAACTCGAGTTAACGGCTGAATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3836s1c1
Sequence:CCGGGCAGGTCTATTCGTTCTCCTTCTCGAGAAGGAGAACGAATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003184
VALIDATED
TAF2 MISSION shRNA shRNA Plasmid DNA
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003184.3-4188s21c1
Sequence:CCGGGTACCGCCAAAGTCAATTATGCTCGAGCATAATTGACTTTGGCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-3028s21c1
Sequence:CCGGCCCTATGTAAGGCATAAGATTCTCGAGAATCTTATGCCTTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003184.3-331s21c1
Sequence:CCGGGAAAGCCCAAGGCCATATAAACTCGAGTTTATATGGCCTTGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-366s21c1
Sequence:CCGGCGTCTGCATCAACAACATAAACTCGAGTTTATGTTGTTGATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-3317s21c1
Sequence:CCGGGCAACCAAGAAGCTGCAAATACTCGAGTATTTGCAGCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3317s1c1
Sequence:CCGGGCAACCAAGAAGCTGCAAATACTCGAGTATTTGCAGCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3028s1c1
Sequence:CCGGCCCTATGTAAGGCATAAGATTCTCGAGAATCTTATGCCTTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-366s1c1
Sequence:CCGGCGTCTGCATCAACAACATAAACTCGAGTTTATGTTGTTGATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-1805s1c1
Sequence:CCGGGCAAAGATATTCAGCCGTTAACTCGAGTTAACGGCTGAATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3836s1c1
Sequence:CCGGGCAGGTCTATTCGTTCTCCTTCTCGAGAAGGAGAACGAATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003184
VALIDATED
TAF2 MISSION shRNA Lentiviral Transduction Particles
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003184.3-4188s21c1
Sequence:CCGGGTACCGCCAAAGTCAATTATGCTCGAGCATAATTGACTTTGGCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-3028s21c1
Sequence:CCGGCCCTATGTAAGGCATAAGATTCTCGAGAATCTTATGCCTTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003184.3-331s21c1
Sequence:CCGGGAAAGCCCAAGGCCATATAAACTCGAGTTTATATGGCCTTGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-366s21c1
Sequence:CCGGCGTCTGCATCAACAACATAAACTCGAGTTTATGTTGTTGATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003184.3-3317s21c1
Sequence:CCGGGCAACCAAGAAGCTGCAAATACTCGAGTATTTGCAGCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3317s1c1
Sequence:CCGGGCAACCAAGAAGCTGCAAATACTCGAGTATTTGCAGCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3028s1c1
Sequence:CCGGCCCTATGTAAGGCATAAGATTCTCGAGAATCTTATGCCTTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-366s1c1
Sequence:CCGGCGTCTGCATCAACAACATAAACTCGAGTTTATGTTGTTGATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-1805s1c1
Sequence:CCGGGCAAAGATATTCAGCCGTTAACTCGAGTTAACGGCTGAATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003184.2-3836s1c1
Sequence:CCGGGCAGGTCTATTCGTTCTCCTTCTCGAGAAGGAGAACGAATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081288
VALIDATED
TAF2 MISSION shRNA Bacterial Glycerol Stock
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-3233s21c1
Sequence:CCGGGTCTTGAATCCTACCATTATTCTCGAGAATAATGGTAGGATTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-879s21c1
Sequence:CCGGATTTGGTGGAGACCGTGTATACTCGAGTATACACGGTCTCCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-2900s21c1
Sequence:CCGGGCCGTCGTTGATTACACTAAACTCGAGTTTAGTGTAATCAACGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081288.1-4338s21c1
Sequence:CCGGGTAGTACATTTGGTGATTATGCTCGAGCATAATCACCAAATGTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-364s21c1
Sequence:CCGGATTTGTGGAGCTGACTATATTCTCGAGAATATAGTCAGCTCCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081288
VALIDATED
TAF2 MISSION shRNA shRNA Plasmid DNA
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-3233s21c1
Sequence:CCGGGTCTTGAATCCTACCATTATTCTCGAGAATAATGGTAGGATTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-879s21c1
Sequence:CCGGATTTGGTGGAGACCGTGTATACTCGAGTATACACGGTCTCCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-2900s21c1
Sequence:CCGGGCCGTCGTTGATTACACTAAACTCGAGTTTAGTGTAATCAACGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081288.1-4338s21c1
Sequence:CCGGGTAGTACATTTGGTGATTATGCTCGAGCATAATCACCAAATGTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-364s21c1
Sequence:CCGGATTTGTGGAGCTGACTATATTCTCGAGAATATAGTCAGCTCCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081288
VALIDATED
TAF2 MISSION shRNA Lentiviral Transduction Particles
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-3233s21c1
Sequence:CCGGGTCTTGAATCCTACCATTATTCTCGAGAATAATGGTAGGATTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-879s21c1
Sequence:CCGGATTTGGTGGAGACCGTGTATACTCGAGTATACACGGTCTCCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-2900s21c1
Sequence:CCGGGCCGTCGTTGATTACACTAAACTCGAGTTTAGTGTAATCAACGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081288.1-4338s21c1
Sequence:CCGGGTAGTACATTTGGTGATTATGCTCGAGCATAATCACCAAATGTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081288.1-364s21c1
Sequence:CCGGATTTGTGGAGCTGACTATATTCTCGAGAATATAGTCAGCTCCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks