EMAIL THIS PAGE TO A FRIEND

TAF3

TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa

Synonyms: TAF140 TAFII-140 TAFII140
Gene ID:
Human(83860) Summary: The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]
Mouse(209361) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(100360100) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor
sheep(101115725) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
domestic guinea pig(100725489) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Domestic Rabbit(100339754) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
naked mole-rat(101698386) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Zebrafish(334474) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated facto
Horse(100630332) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
domestic cat(101083011) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
dog(487135) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
chicken(419107) TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291729 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031923 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU211881 MISSION® esiRNA esiRNA targeting mouse Taf3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031923 Rosetta Predictions human pricing
XM_291729 Rosetta Predictions human pricing
NM_027748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs02_00359053 predicted 1237
2 SASI_Hs02_00359054 predicted 1200
3 SASI_Hs02_00359055 predicted 1286
4 SASI_Hs02_00359056 predicted 1153
5 SASI_Hs02_00359057 predicted 646
6 SASI_Hs02_00359058 predicted 684
7 SASI_Hs02_00359059 predicted 876
8 SASI_Hs02_00359060 predicted 873
9 SASI_Hs02_00359061 predicted 732
10 SASI_Hs02_00359062 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs01_00298133 predicted 1984
2 SASI_Hs01_00298134 predicted 3927
3 SASI_Hs01_00298135 predicted 1918
4 SASI_Hs01_00298136 predicted 1906
5 SASI_Hs01_00298137 predicted 3914
6 SASI_Hs01_00298138 predicted 748
7 SASI_Hs01_00298139 predicted 3797
8 SASI_Hs01_00298140 predicted 1443
9 SASI_Hs01_00298141 predicted 3907
10 SASI_Hs01_00298142 predicted 1754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm01_00171359 predicted 823
2 SASI_Mm01_00171360 predicted 2833
3 SASI_Mm01_00171361 predicted 2956
4 SASI_Mm01_00171362 predicted 1282
5 SASI_Mm01_00171364 predicted 481
6 SASI_Mm01_00171365 predicted 446
7 SASI_Mm01_00171366 predicted 220
8 SASI_Mm01_00171367 predicted 856
9 SASI_Mm01_00171368 predicted 2849
10 SASI_Mm02_00332701 predicted 578
11 SASI_Mm01_00171363 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291729
VALIDATED
TAF3 MISSION shRNA Bacterial Glycerol Stock
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000016608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_291729.4-1238s1c1
Sequence:CCGGCGGAATCTGAAGGAGACATTTCTCGAGAAATGTCTCCTTCAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291729.4-841s1c1
Sequence:CCGGCAGAAGACTAAATCACCTAAACTCGAGTTTAGGTGATTTAGTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291729.4-298s1c1
Sequence:CCGGCCTGTTAGCAAGAACAATGTACTCGAGTACATTGTTCTTGCTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291729
VALIDATED
TAF3 MISSION shRNA shRNA Plasmid DNA
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000016608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_291729.4-1238s1c1
Sequence:CCGGCGGAATCTGAAGGAGACATTTCTCGAGAAATGTCTCCTTCAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291729.4-841s1c1
Sequence:CCGGCAGAAGACTAAATCACCTAAACTCGAGTTTAGGTGATTTAGTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291729.4-298s1c1
Sequence:CCGGCCTGTTAGCAAGAACAATGTACTCGAGTACATTGTTCTTGCTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291729
VALIDATED
TAF3 MISSION shRNA Lentiviral Transduction Particles
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000016608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_291729.4-1238s1c1
Sequence:CCGGCGGAATCTGAAGGAGACATTTCTCGAGAAATGTCTCCTTCAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291729.4-841s1c1
Sequence:CCGGCAGAAGACTAAATCACCTAAACTCGAGTTTAGGTGATTTAGTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291729.4-298s1c1
Sequence:CCGGCCTGTTAGCAAGAACAATGTACTCGAGTACATTGTTCTTGCTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027748
TAF3 MISSION shRNA Bacterial Glycerol Stock
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027748.1-3289s1c1
Sequence:CCGGGCCCTCTCGATTTCCTTTCTTCTCGAGAAGAAAGGAAATCGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027748.1-3596s1c1
Sequence:CCGGCCTGTGCAGATTGTCTTCATTCTCGAGAATGAAGACAATCTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027748.2-448s1c1
Sequence:CCGGCATGAACTAGAAGACTATATTCTCGAGAATATAGTCTTCTAGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027748.2-1966s1c1
Sequence:CCGGGAAGATTCTGATCCCTATAAGCTCGAGCTTATAGGGATCAGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-541s21c1
Sequence:CCGGTTTCCTCAGCCCGGAAGTAAACTCGAGTTTACTTCCGGGCTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-800s21c1
Sequence:CCGGCACGACTCCTGAGCACTAAAGCTCGAGCTTTAGTGCTCAGGAGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-415s21c1
Sequence:CCGGGGTGAAGCCTTCCAACTTATGCTCGAGCATAAGTTGGAAGGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027748.2-3247s21c1
Sequence:CCGGTATTACCAGTGACAAGTATTACTCGAGTAATACTTGTCACTGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-1001s21c1
Sequence:CCGGCGTTAGAAACAAAGTCGTTTACTCGAGTAAACGACTTTGTTTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027748
TAF3 MISSION shRNA shRNA Plasmid DNA
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027748.1-3289s1c1
Sequence:CCGGGCCCTCTCGATTTCCTTTCTTCTCGAGAAGAAAGGAAATCGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027748.1-3596s1c1
Sequence:CCGGCCTGTGCAGATTGTCTTCATTCTCGAGAATGAAGACAATCTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027748.2-448s1c1
Sequence:CCGGCATGAACTAGAAGACTATATTCTCGAGAATATAGTCTTCTAGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027748.2-1966s1c1
Sequence:CCGGGAAGATTCTGATCCCTATAAGCTCGAGCTTATAGGGATCAGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-541s21c1
Sequence:CCGGTTTCCTCAGCCCGGAAGTAAACTCGAGTTTACTTCCGGGCTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-800s21c1
Sequence:CCGGCACGACTCCTGAGCACTAAAGCTCGAGCTTTAGTGCTCAGGAGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-415s21c1
Sequence:CCGGGGTGAAGCCTTCCAACTTATGCTCGAGCATAAGTTGGAAGGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027748.2-3247s21c1
Sequence:CCGGTATTACCAGTGACAAGTATTACTCGAGTAATACTTGTCACTGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-1001s21c1
Sequence:CCGGCGTTAGAAACAAAGTCGTTTACTCGAGTAAACGACTTTGTTTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027748
TAF3 MISSION shRNA Lentiviral Transduction Particles
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027748.1-3289s1c1
Sequence:CCGGGCCCTCTCGATTTCCTTTCTTCTCGAGAAGAAAGGAAATCGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027748.1-3596s1c1
Sequence:CCGGCCTGTGCAGATTGTCTTCATTCTCGAGAATGAAGACAATCTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027748.2-448s1c1
Sequence:CCGGCATGAACTAGAAGACTATATTCTCGAGAATATAGTCTTCTAGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027748.2-1966s1c1
Sequence:CCGGGAAGATTCTGATCCCTATAAGCTCGAGCTTATAGGGATCAGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-541s21c1
Sequence:CCGGTTTCCTCAGCCCGGAAGTAAACTCGAGTTTACTTCCGGGCTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-800s21c1
Sequence:CCGGCACGACTCCTGAGCACTAAAGCTCGAGCTTTAGTGCTCAGGAGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-415s21c1
Sequence:CCGGGGTGAAGCCTTCCAACTTATGCTCGAGCATAAGTTGGAAGGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027748.2-3247s21c1
Sequence:CCGGTATTACCAGTGACAAGTATTACTCGAGTAATACTTGTCACTGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027748.2-1001s21c1
Sequence:CCGGCGTTAGAAACAAAGTCGTTTACTCGAGTAAACGACTTTGTTTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031923
VALIDATED
TAF3 MISSION shRNA Bacterial Glycerol Stock
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031923.2-232s21c1
Sequence:CCGGCATGAACTAGAAGACTATATTCTCGAGAATATAGTCTTCTAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031923.2-277s21c1
Sequence:CCGGCCACACCAAATTCCGTCATTTCTCGAGAAATGACGGAATTTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031923.2-575s21c1
Sequence:CCGGTGAAGCGGCCTCGGCTATTAACTCGAGTTAATAGCCGAGGCCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031923
VALIDATED
TAF3 MISSION shRNA shRNA Plasmid DNA
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031923.2-232s21c1
Sequence:CCGGCATGAACTAGAAGACTATATTCTCGAGAATATAGTCTTCTAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031923.2-277s21c1
Sequence:CCGGCCACACCAAATTCCGTCATTTCTCGAGAAATGACGGAATTTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031923.2-575s21c1
Sequence:CCGGTGAAGCGGCCTCGGCTATTAACTCGAGTTAATAGCCGAGGCCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031923
VALIDATED
TAF3 MISSION shRNA Lentiviral Transduction Particles
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031923.2-232s21c1
Sequence:CCGGCATGAACTAGAAGACTATATTCTCGAGAATATAGTCTTCTAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031923.2-277s21c1
Sequence:CCGGCCACACCAAATTCCGTCATTTCTCGAGAAATGACGGAATTTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031923.2-575s21c1
Sequence:CCGGTGAAGCGGCCTCGGCTATTAACTCGAGTTAATAGCCGAGGCCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks