EMAIL THIS PAGE TO A FRIEND

TAF4

TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa

Synonyms: TAF2C TAF2C1 TAF4A TAFII130 TAFII135
UniProtKB ID: O00268, A6NGD9, Q5TBP6, Q99721, Q9BR40, Q9BX42
Gene ID:
Human(6874) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
fruit fly(39765) TBP-associated factor 4
Thale Cress(834330) TBP-associated factor 4
domestic cat(101085454) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
Horse(100057726) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
dog(477280) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
chicken(419223) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
naked mole-rat(101708033) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
domestic guinea pig(100720485) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
cow(789854) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
sheep(101122456) TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA008599 Anti-TAF4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102365 Anti-TAF4 antibody produced in rabbit affinity isolated antibody canine, guinea pig, rabbit, bovine, pig, rat, mouse, human, horse
western blot pricing
SAB4502918 Anti-TAF4, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003185 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058351 MISSION® esiRNA esiRNA human TAF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003185 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048600 predicted 1913
2 SASI_Hs01_00048601 predicted 2935
3 SASI_Hs02_00335215 predicted 3228
4 SASI_Hs01_00048602 predicted 1943
5 SASI_Hs01_00048603 predicted 1975
6 SASI_Hs01_00048604 predicted 2621
7 SASI_Hs01_00048605 predicted 2632
8 SASI_Hs01_00048606 predicted 2681
9 SASI_Hs01_00048607 predicted 2516
10 SASI_Hs01_00048608 predicted 2677
11 SASI_Hs01_00048609 predicted 1582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003185
VALIDATED
TAF4 MISSION shRNA Bacterial Glycerol Stock
TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003185.3-2485s21c1
Sequence:CCGGCGGGACGATGATGACATTAATCTCGAGATTAATGTCATCATCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003185.3-3644s21c1
Sequence:CCGGATGACCTCATTTCGTTTATTTCTCGAGAAATAAACGAAATGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003185.3-2782s21c1
Sequence:CCGGTACAAGGATGACGACAGATATCTCGAGATATCTGTCGTCATCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003185.3-2584s21c1
Sequence:CCGGACGCTAACGCGGTCCTGTAAACTCGAGTTTACAGGACCGCGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003185.3-2683s21c1
Sequence:CCGGCATCCAGATGTAGTAAGTTATCTCGAGATAACTTACTACATCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-1910s1c1
Sequence:CCGGGCAGGTTATACCGAGAACTTACTCGAGTAAGTTCTCGGTATAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-2929s1c1
Sequence:CCGGCCAGAACAGTTAAGGCTGAAACTCGAGTTTCAGCCTTAACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003185.2-1516s1c1
Sequence:CCGGGCACCTGGAACACCTATCATTCTCGAGAATGATAGGTGTTCCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-2585s1c1
Sequence:CCGGCGCGGTCCTGTAAAGATGAAACTCGAGTTTCATCTTTACAGGACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003185.2-2680s1c1
Sequence:CCGGCCAGATGTAGTAAGTTATGTACTCGAGTACATAACTTACTACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003185
VALIDATED
TAF4 MISSION shRNA shRNA Plasmid DNA
TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003185.3-2485s21c1
Sequence:CCGGCGGGACGATGATGACATTAATCTCGAGATTAATGTCATCATCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003185.3-3644s21c1
Sequence:CCGGATGACCTCATTTCGTTTATTTCTCGAGAAATAAACGAAATGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003185.3-2782s21c1
Sequence:CCGGTACAAGGATGACGACAGATATCTCGAGATATCTGTCGTCATCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003185.3-2584s21c1
Sequence:CCGGACGCTAACGCGGTCCTGTAAACTCGAGTTTACAGGACCGCGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003185.3-2683s21c1
Sequence:CCGGCATCCAGATGTAGTAAGTTATCTCGAGATAACTTACTACATCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-1910s1c1
Sequence:CCGGGCAGGTTATACCGAGAACTTACTCGAGTAAGTTCTCGGTATAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-2929s1c1
Sequence:CCGGCCAGAACAGTTAAGGCTGAAACTCGAGTTTCAGCCTTAACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003185.2-1516s1c1
Sequence:CCGGGCACCTGGAACACCTATCATTCTCGAGAATGATAGGTGTTCCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-2585s1c1
Sequence:CCGGCGCGGTCCTGTAAAGATGAAACTCGAGTTTCATCTTTACAGGACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003185.2-2680s1c1
Sequence:CCGGCCAGATGTAGTAAGTTATGTACTCGAGTACATAACTTACTACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003185
VALIDATED
TAF4 MISSION shRNA Lentiviral Transduction Particles
TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003185.3-2485s21c1
Sequence:CCGGCGGGACGATGATGACATTAATCTCGAGATTAATGTCATCATCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003185.3-3644s21c1
Sequence:CCGGATGACCTCATTTCGTTTATTTCTCGAGAAATAAACGAAATGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003185.3-2782s21c1
Sequence:CCGGTACAAGGATGACGACAGATATCTCGAGATATCTGTCGTCATCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003185.3-2584s21c1
Sequence:CCGGACGCTAACGCGGTCCTGTAAACTCGAGTTTACAGGACCGCGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003185.3-2683s21c1
Sequence:CCGGCATCCAGATGTAGTAAGTTATCTCGAGATAACTTACTACATCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-1910s1c1
Sequence:CCGGGCAGGTTATACCGAGAACTTACTCGAGTAAGTTCTCGGTATAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-2929s1c1
Sequence:CCGGCCAGAACAGTTAAGGCTGAAACTCGAGTTTCAGCCTTAACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003185.2-1516s1c1
Sequence:CCGGGCACCTGGAACACCTATCATTCTCGAGAATGATAGGTGTTCCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003185.2-2585s1c1
Sequence:CCGGCGCGGTCCTGTAAAGATGAAACTCGAGTTTCATCTTTACAGGACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003185.2-2680s1c1
Sequence:CCGGCCAGATGTAGTAAGTTATGTACTCGAGTACATAACTTACTACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks