EMAIL THIS PAGE TO A FRIEND

TAF4B

TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa

Synonyms: TAF2C2 TAFII105
UniProtKB ID: Q92750, Q29YA4, Q29YA5
Gene ID:
Human(6875) Summary: TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. [provided by RefSeq, Sep 2011]
Mouse(72504) TAF4B RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(680806) TAF4B RNA polymerase II, TATA box binding protein (TBP)-associated factor
domestic guinea pig(100715336) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
naked mole-rat(101702563) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Domestic Rabbit(100349838) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
cow(518030) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
sheep(101117382) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Thale Cress(839665) TBP-associated factor 4B
chicken(421086) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Horse(100064447) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
domestic cat(101101673) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
dog(490507) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Zebrafish(100150678) TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_290809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005640 Rosetta Predictions human pricing
XM_290809 Rosetta Predictions human pricing
XM_001058968 Rosetta Predictions rat pricing
XM_128905 Rosetta Predictions mouse pricing
XM_911701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339978 predicted 2957
2 SASI_Hs02_00339979 predicted 787
3 SASI_Hs02_00339980 predicted 2890
4 SASI_Hs02_00339981 predicted 2642
5 SASI_Hs02_00339982 predicted 2607
6 SASI_Hs02_00339983 predicted 1523
7 SASI_Hs02_00339984 predicted 759
8 SASI_Hs02_00339985 predicted 1899
9 SASI_Hs02_00339986 predicted 1513
10 SASI_Hs02_00339987 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282359 predicted 3224
2 SASI_Hs01_00282360 predicted 1392
3 SASI_Hs01_00282361 predicted 1039
4 SASI_Hs01_00282362 predicted 3166
5 SASI_Hs01_00282363 predicted 1902
6 SASI_Hs01_00282364 predicted 2907
7 SASI_Hs01_00282365 predicted 1403
8 SASI_Hs01_00282366 predicted 2791
9 SASI_Hs01_00282367 predicted 2052
10 SASI_Hs01_00282368 predicted 2876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291453 predicted 657
2 SASI_Rn02_00291454 predicted 753
3 SASI_Rn02_00291455 predicted 618
4 SASI_Rn02_00291456 predicted 495
5 SASI_Rn02_00291457 predicted 650
6 SASI_Rn02_00291458 predicted 653
7 SASI_Rn02_00291459 predicted 749
8 SASI_Rn02_00291460 predicted 787
9 SASI_Rn02_00291461 predicted 702
10 SASI_Rn02_00291462 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255725 predicted 1330
2 SASI_Mm01_00255726 predicted 2252
3 SASI_Mm02_00424272 predicted 3016
4 SASI_Mm02_00424273 predicted 2333
5 SASI_Mm01_00255729 predicted 2720
6 SASI_Mm02_00424274 predicted 2581
7 SASI_Mm01_00255730 predicted 2484
8 SASI_Mm01_00255731 predicted 1012
9 SASI_Mm01_00255732 predicted 2889
10 SASI_Mm02_00424275 predicted 654
11 SASI_Mm01_00255723 predicted 1903
12 SASI_Mm01_00255724 predicted 2029
13 SASI_Mm01_00255727 predicted 2852
14 SASI_Mm01_00255728 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436578 predicted 1334
2 SASI_Mm02_00436579 predicted 2259
3 SASI_Mm02_00436580 predicted 3016
4 SASI_Mm02_00436581 predicted 2342
5 SASI_Mm02_00436582 predicted 2720
6 SASI_Mm02_00436583 predicted 2583
7 SASI_Mm02_00436584 predicted 2485
8 SASI_Mm02_00436585 predicted 1012
9 SASI_Mm02_00436586 predicted 2891
10 SASI_Mm02_00436587 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005640
VALIDATED
TAF4B MISSION shRNA Bacterial Glycerol Stock
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005640.1-3341s21c1
Sequence:CCGGAGCAAGTTAAGGCCCTATTTGCTCGAGCAAATAGGGCCTTAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-975s21c1
Sequence:CCGGGCCGAACTCTAGCTCACAATTCTCGAGAATTGTGAGCTAGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005640.1-902s21c1
Sequence:CCGGCCGAGACCACAAGTAACATAACTCGAGTTATGTTACTTGTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-1197s21c1
Sequence:CCGGGCCCAATCTTAAAGCAGAGAACTCGAGTTCTCTGCTTTAAGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-1387s21c1
Sequence:CCGGGCAGAAGAATTTACTAGGAAACTCGAGTTTCCTAGTAAATTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005640
VALIDATED
TAF4B MISSION shRNA shRNA Plasmid DNA
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005640.1-3341s21c1
Sequence:CCGGAGCAAGTTAAGGCCCTATTTGCTCGAGCAAATAGGGCCTTAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-975s21c1
Sequence:CCGGGCCGAACTCTAGCTCACAATTCTCGAGAATTGTGAGCTAGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005640.1-902s21c1
Sequence:CCGGCCGAGACCACAAGTAACATAACTCGAGTTATGTTACTTGTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-1197s21c1
Sequence:CCGGGCCCAATCTTAAAGCAGAGAACTCGAGTTCTCTGCTTTAAGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-1387s21c1
Sequence:CCGGGCAGAAGAATTTACTAGGAAACTCGAGTTTCCTAGTAAATTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005640
VALIDATED
TAF4B MISSION shRNA Lentiviral Transduction Particles
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005640.1-3341s21c1
Sequence:CCGGAGCAAGTTAAGGCCCTATTTGCTCGAGCAAATAGGGCCTTAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-975s21c1
Sequence:CCGGGCCGAACTCTAGCTCACAATTCTCGAGAATTGTGAGCTAGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005640.1-902s21c1
Sequence:CCGGCCGAGACCACAAGTAACATAACTCGAGTTATGTTACTTGTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-1197s21c1
Sequence:CCGGGCCCAATCTTAAAGCAGAGAACTCGAGTTCTCTGCTTTAAGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005640.1-1387s21c1
Sequence:CCGGGCAGAAGAATTTACTAGGAAACTCGAGTTTCCTAGTAAATTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128905
VALIDATED
TAF4B MISSION shRNA Bacterial Glycerol Stock
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-3245s21c1
Sequence:CCGGGTATCTAGATGTGGGATAAAGCTCGAGCTTTATCCCACATCTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-760s21c1
Sequence:CCGGCCAAGACCACAAGTAACATAACTCGAGTTATGTTACTTGTGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-2586s21c1
Sequence:CCGGGCCAAGAGTCGCTCCAATAAACTCGAGTTTATTGGAGCGACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128905.6-657s21c1
Sequence:CCGGATCCAACTACCGGCTAATTTGCTCGAGCAAATTAGCCGGTAGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-2441s21c1
Sequence:CCGGTCAGCATCGAATGACTATTTACTCGAGTAAATAGTCATTCGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128905
VALIDATED
TAF4B MISSION shRNA shRNA Plasmid DNA
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-3245s21c1
Sequence:CCGGGTATCTAGATGTGGGATAAAGCTCGAGCTTTATCCCACATCTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-760s21c1
Sequence:CCGGCCAAGACCACAAGTAACATAACTCGAGTTATGTTACTTGTGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-2586s21c1
Sequence:CCGGGCCAAGAGTCGCTCCAATAAACTCGAGTTTATTGGAGCGACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128905.6-657s21c1
Sequence:CCGGATCCAACTACCGGCTAATTTGCTCGAGCAAATTAGCCGGTAGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-2441s21c1
Sequence:CCGGTCAGCATCGAATGACTATTTACTCGAGTAAATAGTCATTCGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128905
VALIDATED
TAF4B MISSION shRNA Lentiviral Transduction Particles
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-3245s21c1
Sequence:CCGGGTATCTAGATGTGGGATAAAGCTCGAGCTTTATCCCACATCTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-760s21c1
Sequence:CCGGCCAAGACCACAAGTAACATAACTCGAGTTATGTTACTTGTGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-2586s21c1
Sequence:CCGGGCCAAGAGTCGCTCCAATAAACTCGAGTTTATTGGAGCGACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128905.6-657s21c1
Sequence:CCGGATCCAACTACCGGCTAATTTGCTCGAGCAAATTAGCCGGTAGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_128905.6-2441s21c1
Sequence:CCGGTCAGCATCGAATGACTATTTACTCGAGTAAATAGTCATTCGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290809
VALIDATED
TAF4B MISSION shRNA Bacterial Glycerol Stock
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-990s1c1
Sequence:CCGGGCCCAATCTTAAAGCAGAGAACTCGAGTTCTCTGCTTTAAGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-1180s1c1
Sequence:CCGGGCAGAAGAATTTACTAGGAAACTCGAGTTTCCTAGTAAATTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-2335s1c1
Sequence:CCGGGCTGTGAACTTGATCTCCCAACTCGAGTTGGGAGATCAAGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_290809.3-2225s1c1
Sequence:CCGGGCACACTCATTCAGTCATGTACTCGAGTACATGACTGAATGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_290809.3-768s1c1
Sequence:CCGGGCCGAACTCTAGCTCACAATTCTCGAGAATTGTGAGCTAGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-2335s1c2
Sequence:CCGGGCTGTGAACTTGATCTCCCAACTCGAGTTGGGAGATCAAGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290809
VALIDATED
TAF4B MISSION shRNA shRNA Plasmid DNA
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-990s1c1
Sequence:CCGGGCCCAATCTTAAAGCAGAGAACTCGAGTTCTCTGCTTTAAGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-1180s1c1
Sequence:CCGGGCAGAAGAATTTACTAGGAAACTCGAGTTTCCTAGTAAATTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-2335s1c1
Sequence:CCGGGCTGTGAACTTGATCTCCCAACTCGAGTTGGGAGATCAAGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_290809.3-2225s1c1
Sequence:CCGGGCACACTCATTCAGTCATGTACTCGAGTACATGACTGAATGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_290809.3-768s1c1
Sequence:CCGGGCCGAACTCTAGCTCACAATTCTCGAGAATTGTGAGCTAGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-2335s1c2
Sequence:CCGGGCTGTGAACTTGATCTCCCAACTCGAGTTGGGAGATCAAGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290809
VALIDATED
TAF4B MISSION shRNA Lentiviral Transduction Particles
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-990s1c1
Sequence:CCGGGCCCAATCTTAAAGCAGAGAACTCGAGTTCTCTGCTTTAAGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-1180s1c1
Sequence:CCGGGCAGAAGAATTTACTAGGAAACTCGAGTTTCCTAGTAAATTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-2335s1c1
Sequence:CCGGGCTGTGAACTTGATCTCCCAACTCGAGTTGGGAGATCAAGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_290809.3-2225s1c1
Sequence:CCGGGCACACTCATTCAGTCATGTACTCGAGTACATGACTGAATGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_290809.3-768s1c1
Sequence:CCGGGCCGAACTCTAGCTCACAATTCTCGAGAATTGTGAGCTAGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290809.3-2335s1c2
Sequence:CCGGGCTGTGAACTTGATCTCCCAACTCGAGTTGGGAGATCAAGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks