EMAIL THIS PAGE TO A FRIEND

TAF5

TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa

Synonyms: TAF2D TAFII100
Gene ID:
Human(6877) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes an integral subunit of TFIID associated with all transcriptionally competent forms of that complex. This subunit interacts strongly with two TFIID subunits that show similarity to histones H3 and H4, and it may participate in forming a nucleosome-like core in the TFIID complex. [provided by RefSeq, Jul 2008]
Mouse(226182) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(294018) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor
fruit fly(47900) TBP-associated factor 5
Horse(100059739) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
domestic cat(101086424) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
dog(100688981) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
chicken(423872) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
Thale Cress(832586) TBP-associated factor 5
Zebrafish(641491) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor
cow(516001) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
sheep(101110984) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
naked mole-rat(101703818) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
domestic guinea pig(100722283) TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006951 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006951 Rosetta Predictions human pricing
NM_001106365 Rosetta Predictions rat pricing
NM_177342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237589 predicted 631
2 SASI_Hs01_00237590 predicted 2316
3 SASI_Hs02_00342673 predicted 2094
4 SASI_Hs01_00237591 predicted 566
5 SASI_Hs01_00237592 predicted 1775
6 SASI_Hs01_00237594 predicted 1800
7 SASI_Hs01_00237595 predicted 1552
8 SASI_Hs01_00237596 predicted 2414
9 SASI_Hs01_00237597 predicted 769
10 SASI_Hs01_00237598 predicted 2253
11 SASI_Hs01_00237593 predicted 2345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218248 predicted 2312
2 SASI_Rn02_00218249 predicted 643
3 SASI_Rn02_00218250 predicted 1548
4 SASI_Rn02_00218251 predicted 2340
5 SASI_Rn02_00218252 predicted 625
6 SASI_Rn02_00218253 predicted 2155
7 SASI_Rn02_00218254 predicted 922
8 SASI_Rn02_00218255 predicted 2410
9 SASI_Rn02_00218256 predicted 2256
10 SASI_Rn02_00218257 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186935 predicted 910
2 SASI_Mm01_00186936 predicted 2304
3 SASI_Mm01_00186937 predicted 884
4 SASI_Mm01_00186939 predicted 649
5 SASI_Mm01_00186940 predicted 2335
6 SASI_Mm01_00186941 predicted 1545
7 SASI_Mm01_00186942 predicted 2225
8 SASI_Mm01_00186943 predicted 2408
9 SASI_Mm02_00347471 predicted 1652
10 SASI_Mm02_00347472 predicted 752
11 SASI_Mm01_00186938 predicted 2172
12 SASI_Mm01_00186944 predicted 1461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177342
VALIDATED
TAF5 MISSION shRNA Bacterial Glycerol Stock
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177342.2-650s1c1
Sequence:CCGGCCCTACAATGTATGAAGAATACTCGAGTATTCTTCATACATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-1733s1c1
Sequence:CCGGCCTTCAGACTTTCACTTGCTTCTCGAGAAGCAAGTGAAAGTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-1119s1c1
Sequence:CCGGGCGAACAAATCGAAGGTATTTCTCGAGAAATACCTTCGATTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-2146s1c1
Sequence:CCGGGCCACACTGATACAGTGTGTTCTCGAGAACACACTGTATCAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177342.2-720s1c1
Sequence:CCGGGCAGAGTTATCCCAACTCTTTCTCGAGAAAGAGTTGGGATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2416s21c1
Sequence:CCGGCGCAATAAGCCAACGGTATTACTCGAGTAATACCGTTGGCTTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2319s21c1
Sequence:CCGGGAGTTGTTATTGGGTACATATCTCGAGATATGTACCCAATAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-1869s21c1
Sequence:CCGGTATCAGCCTTTGAGGATATTTCTCGAGAAATATCCTCAAAGGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2095s21c1
Sequence:CCGGGAGTACTTCTTTGGGATATTGCTCGAGCAATATCCCAAAGAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-1547s21c1
Sequence:CCGGAGCATCAGATCTTAGTCTTATCTCGAGATAAGACTAAGATCTGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177342.3-2588s21c1
Sequence:CCGGGCAACCACATTTAACTAATTTCTCGAGAAATTAGTTAAATGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177342
VALIDATED
TAF5 MISSION shRNA shRNA Plasmid DNA
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177342.2-650s1c1
Sequence:CCGGCCCTACAATGTATGAAGAATACTCGAGTATTCTTCATACATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-1733s1c1
Sequence:CCGGCCTTCAGACTTTCACTTGCTTCTCGAGAAGCAAGTGAAAGTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-1119s1c1
Sequence:CCGGGCGAACAAATCGAAGGTATTTCTCGAGAAATACCTTCGATTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-2146s1c1
Sequence:CCGGGCCACACTGATACAGTGTGTTCTCGAGAACACACTGTATCAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177342.2-720s1c1
Sequence:CCGGGCAGAGTTATCCCAACTCTTTCTCGAGAAAGAGTTGGGATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2416s21c1
Sequence:CCGGCGCAATAAGCCAACGGTATTACTCGAGTAATACCGTTGGCTTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2319s21c1
Sequence:CCGGGAGTTGTTATTGGGTACATATCTCGAGATATGTACCCAATAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-1869s21c1
Sequence:CCGGTATCAGCCTTTGAGGATATTTCTCGAGAAATATCCTCAAAGGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2095s21c1
Sequence:CCGGGAGTACTTCTTTGGGATATTGCTCGAGCAATATCCCAAAGAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-1547s21c1
Sequence:CCGGAGCATCAGATCTTAGTCTTATCTCGAGATAAGACTAAGATCTGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177342.3-2588s21c1
Sequence:CCGGGCAACCACATTTAACTAATTTCTCGAGAAATTAGTTAAATGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177342
VALIDATED
TAF5 MISSION shRNA Lentiviral Transduction Particles
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177342.2-650s1c1
Sequence:CCGGCCCTACAATGTATGAAGAATACTCGAGTATTCTTCATACATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-1733s1c1
Sequence:CCGGCCTTCAGACTTTCACTTGCTTCTCGAGAAGCAAGTGAAAGTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-1119s1c1
Sequence:CCGGGCGAACAAATCGAAGGTATTTCTCGAGAAATACCTTCGATTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177342.2-2146s1c1
Sequence:CCGGGCCACACTGATACAGTGTGTTCTCGAGAACACACTGTATCAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177342.2-720s1c1
Sequence:CCGGGCAGAGTTATCCCAACTCTTTCTCGAGAAAGAGTTGGGATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2416s21c1
Sequence:CCGGCGCAATAAGCCAACGGTATTACTCGAGTAATACCGTTGGCTTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2319s21c1
Sequence:CCGGGAGTTGTTATTGGGTACATATCTCGAGATATGTACCCAATAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-1869s21c1
Sequence:CCGGTATCAGCCTTTGAGGATATTTCTCGAGAAATATCCTCAAAGGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-2095s21c1
Sequence:CCGGGAGTACTTCTTTGGGATATTGCTCGAGCAATATCCCAAAGAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177342.3-1547s21c1
Sequence:CCGGAGCATCAGATCTTAGTCTTATCTCGAGATAAGACTAAGATCTGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177342.3-2588s21c1
Sequence:CCGGGCAACCACATTTAACTAATTTCTCGAGAAATTAGTTAAATGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006951
VALIDATED
TAF5 MISSION shRNA Bacterial Glycerol Stock
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006951.2-2818s1c1
Sequence:CCGGGCATGTATGTTTCTGCTGTAACTCGAGTTACAGCAGAAACATACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-1059s1c1
Sequence:CCGGCCGCGTAGTAAGCAACAGATACTCGAGTATCTGTTGCTTACTACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-1897s1c1
Sequence:CCGGGCCATCTTGCTGATGTGAATTCTCGAGAATTCACATCAGCAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-2149s1c1
Sequence:CCGGGCCACACTGATACAGTCTGTTCTCGAGAACAGACTGTATCAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006951.2-1311s1c1
Sequence:CCGGCCTGAGTTGAAAGATTCAGATCTCGAGATCTGAATCTTTCAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006951.3-2420s21c1
Sequence:CCGGACAATAAACCATCGGTATTAACTCGAGTTAATACCGATGGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-1550s21c1
Sequence:CCGGAGCATCAGATCTTAGTCTTATCTCGAGATAAGACTAAGATCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-2396s21c1
Sequence:CCGGTCTAGCTGCAGGAGCTTATAGCTCGAGCTATAAGCTCCTGCAGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-2483s21c1
Sequence:CCGGGCAAATACCTCAGTGATTAATCTCGAGATTAATCACTGAGGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-850s21c1
Sequence:CCGGAGGATGACCTACGAGTATTATCTCGAGATAATACTCGTAGGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006951
VALIDATED
TAF5 MISSION shRNA shRNA Plasmid DNA
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006951.2-2818s1c1
Sequence:CCGGGCATGTATGTTTCTGCTGTAACTCGAGTTACAGCAGAAACATACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-1059s1c1
Sequence:CCGGCCGCGTAGTAAGCAACAGATACTCGAGTATCTGTTGCTTACTACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-1897s1c1
Sequence:CCGGGCCATCTTGCTGATGTGAATTCTCGAGAATTCACATCAGCAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-2149s1c1
Sequence:CCGGGCCACACTGATACAGTCTGTTCTCGAGAACAGACTGTATCAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006951.2-1311s1c1
Sequence:CCGGCCTGAGTTGAAAGATTCAGATCTCGAGATCTGAATCTTTCAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006951.3-2420s21c1
Sequence:CCGGACAATAAACCATCGGTATTAACTCGAGTTAATACCGATGGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-1550s21c1
Sequence:CCGGAGCATCAGATCTTAGTCTTATCTCGAGATAAGACTAAGATCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-2396s21c1
Sequence:CCGGTCTAGCTGCAGGAGCTTATAGCTCGAGCTATAAGCTCCTGCAGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-2483s21c1
Sequence:CCGGGCAAATACCTCAGTGATTAATCTCGAGATTAATCACTGAGGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-850s21c1
Sequence:CCGGAGGATGACCTACGAGTATTATCTCGAGATAATACTCGTAGGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006951
VALIDATED
TAF5 MISSION shRNA Lentiviral Transduction Particles
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006951.2-2818s1c1
Sequence:CCGGGCATGTATGTTTCTGCTGTAACTCGAGTTACAGCAGAAACATACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-1059s1c1
Sequence:CCGGCCGCGTAGTAAGCAACAGATACTCGAGTATCTGTTGCTTACTACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-1897s1c1
Sequence:CCGGGCCATCTTGCTGATGTGAATTCTCGAGAATTCACATCAGCAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006951.2-2149s1c1
Sequence:CCGGGCCACACTGATACAGTCTGTTCTCGAGAACAGACTGTATCAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006951.2-1311s1c1
Sequence:CCGGCCTGAGTTGAAAGATTCAGATCTCGAGATCTGAATCTTTCAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006951.3-2420s21c1
Sequence:CCGGACAATAAACCATCGGTATTAACTCGAGTTAATACCGATGGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-1550s21c1
Sequence:CCGGAGCATCAGATCTTAGTCTTATCTCGAGATAAGACTAAGATCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-2396s21c1
Sequence:CCGGTCTAGCTGCAGGAGCTTATAGCTCGAGCTATAAGCTCCTGCAGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-2483s21c1
Sequence:CCGGGCAAATACCTCAGTGATTAATCTCGAGATTAATCACTGAGGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006951.3-850s21c1
Sequence:CCGGAGGATGACCTACGAGTATTATCTCGAGATAATACTCGTAGGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks