EMAIL THIS PAGE TO A FRIEND

TAF5L

TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa

Synonyms: PAF65B
UniProtKB ID: O75529, Q5TDI5, Q5TDI6, Q8IW31
Gene ID:
Human(27097) Summary: The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(102162) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor
Rat(307927) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor
domestic guinea pig(100727785) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
naked mole-rat(101719629) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Domestic Rabbit(100339666) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
cow(510413) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
sheep(101102368) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Zebrafish(334055) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor
chicken(421538) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
domestic cat(101092295) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Horse(100065406) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
dog(488982) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025247 Rosetta Predictions human pricing
NM_014409 Rosetta Predictions human pricing
NM_001107442 Rosetta Predictions rat pricing
NM_133966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050540 predicted 882
2 SASI_Hs01_00050542 predicted 377
3 SASI_Hs02_00307427 predicted 686
4 SASI_Hs01_00050543 predicted 295
5 SASI_Hs02_00307428 predicted 893
6 SASI_Hs01_00050544 predicted 714
7 SASI_Hs01_00050545 predicted 529
8 SASI_Hs01_00050546 predicted 313
9 SASI_Hs01_00050547 predicted 736
10 SASI_Hs01_00050548 predicted 777
11 SASI_Hs01_00050541 predicted 442
12 SASI_Hs01_00050549 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075194 predicted 879
2 SASI_Hs01_00075196 predicted 377
3 SASI_Hs02_00345597 predicted 688
4 SASI_Hs01_00075197 predicted 288
5 SASI_Hs02_00345598 predicted 896
6 SASI_Hs01_00075198 predicted 714
7 SASI_Hs01_00075199 predicted 531
8 SASI_Hs01_00075200 predicted 309
9 SASI_Hs01_00075201 predicted 738
10 SASI_Hs01_00075202 predicted 778
11 SASI_Hs01_00075195 predicted 434
12 SASI_Hs01_00075203 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228865 predicted 958
2 SASI_Rn02_00228866 predicted 778
3 SASI_Rn02_00228867 predicted 451
4 SASI_Rn02_00228868 predicted 1185
5 SASI_Rn02_00228869 predicted 911
6 SASI_Rn02_00228870 predicted 434
7 SASI_Rn02_00228871 predicted 855
8 SASI_Rn02_00228872 predicted 567
9 SASI_Rn02_00228873 predicted 679
10 SASI_Rn02_00228874 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084335 predicted 381
2 SASI_Mm01_00084336 predicted 365
3 SASI_Mm01_00084337 predicted 1206
4 SASI_Mm01_00084338 predicted 588
5 SASI_Mm01_00084339 predicted 972
6 SASI_Mm01_00084340 predicted 1087
7 SASI_Mm01_00084341 predicted 386
8 SASI_Mm01_00084342 predicted 455
9 SASI_Mm01_00084343 predicted 854
10 SASI_Mm01_00084344 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133966
VALIDATED
TAF5L MISSION shRNA Bacterial Glycerol Stock
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-1370s21c1
Sequence:CCGGACGTACCCGCTGAGGATATATCTCGAGATATATCCTCAGCGGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-562s21c1
Sequence:CCGGCCAGGACATTCTGTCAAACTTCTCGAGAAGTTTGACAGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-593s21c1
Sequence:CCGGGCATTCCTGGACAACAAGTATCTCGAGATACTTGTTGTCCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-2317s21c1
Sequence:CCGGACTCCTGGCACTGGCTATAATCTCGAGATTATAGCCAGTGCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-465s21c1
Sequence:CCGGGCACCGTGGAAAGCTTCTATACTCGAGTATAGAAGCTTTCCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-1594s1c1
Sequence:CCGGGCGGTTAAAGTTGTGGGACTTCTCGAGAAGTCCCACAACTTTAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-562s1c1
Sequence:CCGGCCAGGACATTCTGTCAAACTTCTCGAGAAGTTTGACAGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-593s1c1
Sequence:CCGGGCATTCCTGGACAACAAGTATCTCGAGATACTTGTTGTCCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-1311s1c1
Sequence:CCGGGCCTGTACTTTGCCAGTGGATCTCGAGATCCACTGGCAAAGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-264s1c1
Sequence:CCGGCAGTCCAATCAGAATCTGGTTCTCGAGAACCAGATTCTGATTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133966
VALIDATED
TAF5L MISSION shRNA shRNA Plasmid DNA
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-1370s21c1
Sequence:CCGGACGTACCCGCTGAGGATATATCTCGAGATATATCCTCAGCGGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-562s21c1
Sequence:CCGGCCAGGACATTCTGTCAAACTTCTCGAGAAGTTTGACAGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-593s21c1
Sequence:CCGGGCATTCCTGGACAACAAGTATCTCGAGATACTTGTTGTCCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-2317s21c1
Sequence:CCGGACTCCTGGCACTGGCTATAATCTCGAGATTATAGCCAGTGCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-465s21c1
Sequence:CCGGGCACCGTGGAAAGCTTCTATACTCGAGTATAGAAGCTTTCCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-1594s1c1
Sequence:CCGGGCGGTTAAAGTTGTGGGACTTCTCGAGAAGTCCCACAACTTTAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-562s1c1
Sequence:CCGGCCAGGACATTCTGTCAAACTTCTCGAGAAGTTTGACAGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-593s1c1
Sequence:CCGGGCATTCCTGGACAACAAGTATCTCGAGATACTTGTTGTCCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-1311s1c1
Sequence:CCGGGCCTGTACTTTGCCAGTGGATCTCGAGATCCACTGGCAAAGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-264s1c1
Sequence:CCGGCAGTCCAATCAGAATCTGGTTCTCGAGAACCAGATTCTGATTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133966
VALIDATED
TAF5L MISSION shRNA Lentiviral Transduction Particles
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-1370s21c1
Sequence:CCGGACGTACCCGCTGAGGATATATCTCGAGATATATCCTCAGCGGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-562s21c1
Sequence:CCGGCCAGGACATTCTGTCAAACTTCTCGAGAAGTTTGACAGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-593s21c1
Sequence:CCGGGCATTCCTGGACAACAAGTATCTCGAGATACTTGTTGTCCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-2317s21c1
Sequence:CCGGACTCCTGGCACTGGCTATAATCTCGAGATTATAGCCAGTGCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133966.2-465s21c1
Sequence:CCGGGCACCGTGGAAAGCTTCTATACTCGAGTATAGAAGCTTTCCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-1594s1c1
Sequence:CCGGGCGGTTAAAGTTGTGGGACTTCTCGAGAAGTCCCACAACTTTAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-562s1c1
Sequence:CCGGCCAGGACATTCTGTCAAACTTCTCGAGAAGTTTGACAGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-593s1c1
Sequence:CCGGGCATTCCTGGACAACAAGTATCTCGAGATACTTGTTGTCCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-1311s1c1
Sequence:CCGGGCCTGTACTTTGCCAGTGGATCTCGAGATCCACTGGCAAAGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133966.1-264s1c1
Sequence:CCGGCAGTCCAATCAGAATCTGGTTCTCGAGAACCAGATTCTGATTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014409
VALIDATED
TAF5L MISSION shRNA Bacterial Glycerol Stock
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014409.3-1332s21c1
Sequence:GTACCGGATCTGGACATCAGTCCATATACTCGAGTATATGGACTGATGTCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014409.3-2401s21c1
Sequence:CCGGGATCCTGGCAAATAGTCTTTCCTCGAGGAAAGACTATTTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014409.3-1412s21c1
Sequence:CCGGACGTACCCGCTGAGGATATATCTCGAGATATATCCTCAGCGGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014409.3-1093s21c1
Sequence:CCGGAGACGTGTCCCGCATCCATTTCTCGAGAAATGGATGCGGGACACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014409.3-385s21c1
Sequence:CCGGGTTTGGACGACTGCGGAATTTCTCGAGAAATTCCGCAGTCGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-225s1c1
Sequence:CCGGCGGCCAATCTAACAGTGCAATCTCGAGATTGCACTGTTAGATTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-1399s1c1
Sequence:CCGGCCACCCTAATTCAAACTACTTCTCGAGAAGTAGTTTGAATTAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-698s1c1
Sequence:CCGGCCTGCCAAGAGAACAGACTATCTCGAGATAGTCTGTTCTCTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014409.2-559s1c1
Sequence:CCGGGCTTCGAGCATTCCTAGATAACTCGAGTTATCTAGGAATGCTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-1034s1c1
Sequence:CCGGCGCATCCATTTGGCTTGTGATCTCGAGATCACAAGCCAAATGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014409
VALIDATED
TAF5L MISSION shRNA shRNA Plasmid DNA
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014409.3-1332s21c1
Sequence:GTACCGGATCTGGACATCAGTCCATATACTCGAGTATATGGACTGATGTCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014409.3-2401s21c1
Sequence:CCGGGATCCTGGCAAATAGTCTTTCCTCGAGGAAAGACTATTTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014409.3-1412s21c1
Sequence:CCGGACGTACCCGCTGAGGATATATCTCGAGATATATCCTCAGCGGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014409.3-1093s21c1
Sequence:CCGGAGACGTGTCCCGCATCCATTTCTCGAGAAATGGATGCGGGACACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014409.3-385s21c1
Sequence:CCGGGTTTGGACGACTGCGGAATTTCTCGAGAAATTCCGCAGTCGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-225s1c1
Sequence:CCGGCGGCCAATCTAACAGTGCAATCTCGAGATTGCACTGTTAGATTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-1399s1c1
Sequence:CCGGCCACCCTAATTCAAACTACTTCTCGAGAAGTAGTTTGAATTAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-698s1c1
Sequence:CCGGCCTGCCAAGAGAACAGACTATCTCGAGATAGTCTGTTCTCTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014409.2-559s1c1
Sequence:CCGGGCTTCGAGCATTCCTAGATAACTCGAGTTATCTAGGAATGCTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-1034s1c1
Sequence:CCGGCGCATCCATTTGGCTTGTGATCTCGAGATCACAAGCCAAATGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014409
VALIDATED
TAF5L MISSION shRNA Lentiviral Transduction Particles
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014409.3-1332s21c1
Sequence:GTACCGGATCTGGACATCAGTCCATATACTCGAGTATATGGACTGATGTCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014409.3-2401s21c1
Sequence:CCGGGATCCTGGCAAATAGTCTTTCCTCGAGGAAAGACTATTTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014409.3-1412s21c1
Sequence:CCGGACGTACCCGCTGAGGATATATCTCGAGATATATCCTCAGCGGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014409.3-1093s21c1
Sequence:CCGGAGACGTGTCCCGCATCCATTTCTCGAGAAATGGATGCGGGACACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014409.3-385s21c1
Sequence:CCGGGTTTGGACGACTGCGGAATTTCTCGAGAAATTCCGCAGTCGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-225s1c1
Sequence:CCGGCGGCCAATCTAACAGTGCAATCTCGAGATTGCACTGTTAGATTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-1399s1c1
Sequence:CCGGCCACCCTAATTCAAACTACTTCTCGAGAAGTAGTTTGAATTAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-698s1c1
Sequence:CCGGCCTGCCAAGAGAACAGACTATCTCGAGATAGTCTGTTCTCTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014409.2-559s1c1
Sequence:CCGGGCTTCGAGCATTCCTAGATAACTCGAGTTATCTAGGAATGCTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014409.2-1034s1c1
Sequence:CCGGCGCATCCATTTGGCTTGTGATCTCGAGATCACAAGCCAAATGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks