EMAIL THIS PAGE TO A FRIEND

TAF6

TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa

Synonyms: MGC:8964 TAF(II)70 TAF(II)80 TAF2E TAFII-70 TAFII-80 TAFII70 TAFII80 TAFII85
UniProtKB ID: P49848, A4D2B2, A4D2B3, B4DT11, D6W5U2, Q6AI29
Gene ID:
Human(6878) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds weakly to TBP but strongly to TAF1, the largest subunit of TFIID. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Mouse(21343) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(288533) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor
fruit fly(40134) TBP-associated factor 6
Zebrafish(447818) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor
chicken(776310) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
dog(489846) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
domestic cat(101088899) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
Horse(100067303) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
cow(505638) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
sheep(101123178) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
naked mole-rat(101726460) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
domestic guinea pig(100719322) TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38652 Anti-TAF6 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, mouse, human, canine, zebrafish, guinea pig, rat, horse, rabbit
western blot pricing
AV34693 Anti-TAF6 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, zebrafish, bovine, guinea pig, canine, human, rat, horse
immunohistochemistry, western blot pricing
HPA006566 Anti-TAF6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102366 Anti-TAF6 antibody produced in rabbit affinity isolated antibody bovine, mouse, canine, rat, guinea pig, rabbit, human, horse
western blot pricing
SAB1411323 Anti-TAF6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0053 AQUA Peptide LTTSDIDYAL[K] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005641 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069961 MISSION® esiRNA esiRNA targeting mouse Taf6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005641 Rosetta Predictions human pricing
NM_139122 Rosetta Predictions human pricing
NM_139123 Rosetta Predictions human pricing
NM_139315 Rosetta Predictions human pricing
NM_001044225 Rosetta Predictions rat pricing
NM_009315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077248 predicted 1490
2 SASI_Hs01_00077249 predicted 1441
3 SASI_Hs01_00077250 predicted 2395
4 SASI_Hs01_00077251 predicted 1435
5 SASI_Hs01_00077252 predicted 1289
6 SASI_Hs01_00077253 predicted 1450
7 SASI_Hs01_00077254 predicted 1674
8 SASI_Hs01_00077255 predicted 1477
9 SASI_Hs01_00077256 predicted 2442
10 SASI_Hs01_00077257 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135774 predicted 1162
2 SASI_Hs01_00135775 predicted 1120
3 SASI_Hs01_00135776 predicted 2041
4 SASI_Hs01_00135777 predicted 1117
5 SASI_Hs01_00135778 predicted 971
6 SASI_Hs01_00135779 predicted 1130
7 SASI_Hs01_00135780 predicted 1348
8 SASI_Hs01_00135781 predicted 1150
9 SASI_Hs01_00135782 predicted 2085
10 SASI_Hs01_00135783 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189328 predicted 1458
2 SASI_Hs01_00189329 predicted 1413
3 SASI_Hs01_00189330 predicted 2362
4 SASI_Hs01_00189331 predicted 1411
5 SASI_Hs01_00189332 predicted 1256
6 SASI_Hs01_00189333 predicted 1426
7 SASI_Hs01_00189334 predicted 1644
8 SASI_Hs01_00189335 predicted 1447
9 SASI_Hs01_00189336 predicted 2409
10 SASI_Hs01_00189337 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122388 predicted 1167
2 SASI_Hs01_00122389 predicted 1114
3 SASI_Hs01_00122390 predicted 2068
4 SASI_Hs01_00122391 predicted 1111
5 SASI_Hs01_00122392 predicted 965
6 SASI_Hs01_00122393 predicted 1129
7 SASI_Hs01_00122394 predicted 1344
8 SASI_Hs01_00122395 predicted 1158
9 SASI_Hs01_00122396 predicted 2119
10 SASI_Hs01_00122397 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204977 predicted 1017
2 SASI_Rn02_00204978 predicted 861
3 SASI_Rn02_00204979 predicted 1713
4 SASI_Rn02_00204980 predicted 303
5 SASI_Rn02_00204981 predicted 923
6 SASI_Rn02_00204982 predicted 304
7 SASI_Rn02_00204983 predicted 893
8 SASI_Rn02_00204984 predicted 1182
9 SASI_Rn02_00204985 predicted 1130
10 SASI_Rn02_00204986 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116910 predicted 1320
2 SASI_Mm01_00116911 predicted 1678
3 SASI_Mm01_00116912 predicted 998
4 SASI_Mm01_00116913 predicted 338
5 SASI_Mm01_00116914 predicted 463
6 SASI_Mm01_00116916 predicted 1111
7 SASI_Mm01_00116917 predicted 212
8 SASI_Mm01_00116918 predicted 283
9 SASI_Mm01_00116919 predicted 1714
10 SASI_Mm02_00315853 predicted 305
11 SASI_Mm01_00116915 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009315
VALIDATED
TAF6 MISSION shRNA Bacterial Glycerol Stock
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-1068s1c1
Sequence:CCGGCCCGAATCACTAAGACCTTTACTCGAGTAAAGGTCTTAGTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009315.1-813s1c1
Sequence:CCGGGTGTGAATGTAGTTCAGAATACTCGAGTATTCTGAACTACATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-926s1c1
Sequence:CCGGCCAGCAGTAATGACCTGCATTCTCGAGAATGCAGGTCATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-213s1c1
Sequence:CCGGCCAGTGACATTGACTATGCATCTCGAGATGCATAGTCAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-1244s1c1
Sequence:CCGGCTGAGCAACATCGACCGTATTCTCGAGAATACGGTCGATGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-1135s21c1
Sequence:CCGGCCCGAATCACTAAGACCTTTACTCGAGTAAAGGTCTTAGTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-993s21c1
Sequence:CCGGCCAGCAGTAATGACCTGCATTCTCGAGAATGCAGGTCATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-1311s21c1
Sequence:CCGGCTGAGCAACATCGACCGTATTCTCGAGAATACGGTCGATGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-280s21c1
Sequence:CCGGCCAGTGACATTGACTATGCATCTCGAGATGCATAGTCAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-880s21c1
Sequence:CCGGGTGTGAATGTAGTTCAGAATACTCGAGTATTCTGAACTACATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009315
VALIDATED
TAF6 MISSION shRNA shRNA Plasmid DNA
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-1068s1c1
Sequence:CCGGCCCGAATCACTAAGACCTTTACTCGAGTAAAGGTCTTAGTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009315.1-813s1c1
Sequence:CCGGGTGTGAATGTAGTTCAGAATACTCGAGTATTCTGAACTACATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-926s1c1
Sequence:CCGGCCAGCAGTAATGACCTGCATTCTCGAGAATGCAGGTCATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-213s1c1
Sequence:CCGGCCAGTGACATTGACTATGCATCTCGAGATGCATAGTCAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-1244s1c1
Sequence:CCGGCTGAGCAACATCGACCGTATTCTCGAGAATACGGTCGATGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-1135s21c1
Sequence:CCGGCCCGAATCACTAAGACCTTTACTCGAGTAAAGGTCTTAGTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-993s21c1
Sequence:CCGGCCAGCAGTAATGACCTGCATTCTCGAGAATGCAGGTCATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-1311s21c1
Sequence:CCGGCTGAGCAACATCGACCGTATTCTCGAGAATACGGTCGATGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-280s21c1
Sequence:CCGGCCAGTGACATTGACTATGCATCTCGAGATGCATAGTCAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-880s21c1
Sequence:CCGGGTGTGAATGTAGTTCAGAATACTCGAGTATTCTGAACTACATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009315
VALIDATED
TAF6 MISSION shRNA Lentiviral Transduction Particles
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-1068s1c1
Sequence:CCGGCCCGAATCACTAAGACCTTTACTCGAGTAAAGGTCTTAGTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009315.1-813s1c1
Sequence:CCGGGTGTGAATGTAGTTCAGAATACTCGAGTATTCTGAACTACATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-926s1c1
Sequence:CCGGCCAGCAGTAATGACCTGCATTCTCGAGAATGCAGGTCATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-213s1c1
Sequence:CCGGCCAGTGACATTGACTATGCATCTCGAGATGCATAGTCAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009315.1-1244s1c1
Sequence:CCGGCTGAGCAACATCGACCGTATTCTCGAGAATACGGTCGATGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-1135s21c1
Sequence:CCGGCCCGAATCACTAAGACCTTTACTCGAGTAAAGGTCTTAGTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-993s21c1
Sequence:CCGGCCAGCAGTAATGACCTGCATTCTCGAGAATGCAGGTCATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-1311s21c1
Sequence:CCGGCTGAGCAACATCGACCGTATTCTCGAGAATACGGTCGATGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-280s21c1
Sequence:CCGGCCAGTGACATTGACTATGCATCTCGAGATGCATAGTCAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009315.3-880s21c1
Sequence:CCGGGTGTGAATGTAGTTCAGAATACTCGAGTATTCTGAACTACATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005641
VALIDATED
TAF6 MISSION shRNA Bacterial Glycerol Stock
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-2587s1c1
Sequence:CCGGCCCCGGATTCCCACACATGCACTCGAGTGCATGTGTGGGAATCCGGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-2132s1c1
Sequence:CCGGCCCTCCTCCAACCAAGTTTATCTCGAGATAAACTTGGTTGGAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-845s1c1
Sequence:CCGGGCTTTACTTCTATGAGGAGAACTCGAGTTCTCCTCATAGAAGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-1691s1c1
Sequence:CCGGCGATGTTATCAAGACTCTGATCTCGAGATCAGAGTCTTGATAACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-1304s1c1
Sequence:CCGGGCCACGGTTCAGTACCTTTATCTCGAGATAAAGGTACTGAACCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-845s21c1
Sequence:CCGGGCTTTACTTCTATGAGGAGAACTCGAGTTCTCCTCATAGAAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-2587s21c1
Sequence:CCGGCCCCGGATTCCCACACATGCACTCGAGTGCATGTGTGGGAATCCGGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-2132s21c1
Sequence:CCGGCCCTCCTCCAACCAAGTTTATCTCGAGATAAACTTGGTTGGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-1691s21c1
Sequence:CCGGCGATGTTATCAAGACTCTGATCTCGAGATCAGAGTCTTGATAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-1304s21c1
Sequence:CCGGGCCACGGTTCAGTACCTTTATCTCGAGATAAAGGTACTGAACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005641
VALIDATED
TAF6 MISSION shRNA shRNA Plasmid DNA
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-2587s1c1
Sequence:CCGGCCCCGGATTCCCACACATGCACTCGAGTGCATGTGTGGGAATCCGGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-2132s1c1
Sequence:CCGGCCCTCCTCCAACCAAGTTTATCTCGAGATAAACTTGGTTGGAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-845s1c1
Sequence:CCGGGCTTTACTTCTATGAGGAGAACTCGAGTTCTCCTCATAGAAGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-1691s1c1
Sequence:CCGGCGATGTTATCAAGACTCTGATCTCGAGATCAGAGTCTTGATAACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-1304s1c1
Sequence:CCGGGCCACGGTTCAGTACCTTTATCTCGAGATAAAGGTACTGAACCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-845s21c1
Sequence:CCGGGCTTTACTTCTATGAGGAGAACTCGAGTTCTCCTCATAGAAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-2587s21c1
Sequence:CCGGCCCCGGATTCCCACACATGCACTCGAGTGCATGTGTGGGAATCCGGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-2132s21c1
Sequence:CCGGCCCTCCTCCAACCAAGTTTATCTCGAGATAAACTTGGTTGGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-1691s21c1
Sequence:CCGGCGATGTTATCAAGACTCTGATCTCGAGATCAGAGTCTTGATAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-1304s21c1
Sequence:CCGGGCCACGGTTCAGTACCTTTATCTCGAGATAAAGGTACTGAACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005641
VALIDATED
TAF6 MISSION shRNA Lentiviral Transduction Particles
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-2587s1c1
Sequence:CCGGCCCCGGATTCCCACACATGCACTCGAGTGCATGTGTGGGAATCCGGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-2132s1c1
Sequence:CCGGCCCTCCTCCAACCAAGTTTATCTCGAGATAAACTTGGTTGGAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-845s1c1
Sequence:CCGGGCTTTACTTCTATGAGGAGAACTCGAGTTCTCCTCATAGAAGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-1691s1c1
Sequence:CCGGCGATGTTATCAAGACTCTGATCTCGAGATCAGAGTCTTGATAACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005641.2-1304s1c1
Sequence:CCGGGCCACGGTTCAGTACCTTTATCTCGAGATAAAGGTACTGAACCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-845s21c1
Sequence:CCGGGCTTTACTTCTATGAGGAGAACTCGAGTTCTCCTCATAGAAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-2587s21c1
Sequence:CCGGCCCCGGATTCCCACACATGCACTCGAGTGCATGTGTGGGAATCCGGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-2132s21c1
Sequence:CCGGCCCTCCTCCAACCAAGTTTATCTCGAGATAAACTTGGTTGGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-1691s21c1
Sequence:CCGGCGATGTTATCAAGACTCTGATCTCGAGATCAGAGTCTTGATAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005641.2-1304s21c1
Sequence:CCGGGCCACGGTTCAGTACCTTTATCTCGAGATAAAGGTACTGAACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks