EMAIL THIS PAGE TO A FRIEND

TAF6L

TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa

Synonyms: PAF65A
UniProtKB ID: Q9Y6J9, B2RAT0, Q96HA6
Gene ID:
Human(10629) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]
Mouse(225895) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor
Rat(309194) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor
Zebrafish(557363) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor
domestic cat(101088188) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
dog(476051) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
domestic guinea pig(100733115) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
naked mole-rat(101698270) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
cow(531109) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
sheep(101112524) TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006473 Rosetta Predictions human pricing
NM_001107575 Rosetta Predictions rat pricing
NM_146092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059914 predicted 1122
2 SASI_Hs01_00059915 predicted 1176
3 SASI_Hs01_00059916 predicted 1774
4 SASI_Hs01_00059917 predicted 713
5 SASI_Hs01_00059918 predicted 1149
6 SASI_Hs01_00059919 predicted 678
7 SASI_Hs01_00059920 predicted 644
8 SASI_Hs01_00059921 predicted 461
9 SASI_Hs01_00059922 predicted 929
10 SASI_Hs01_00059923 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230185 predicted 997
2 SASI_Rn02_00230186 predicted 299
3 SASI_Rn02_00230187 predicted 545
4 SASI_Rn02_00230188 predicted 1241
5 SASI_Rn02_00230189 predicted 914
6 SASI_Rn02_00230190 predicted 985
7 SASI_Rn02_00230191 predicted 1207
8 SASI_Rn02_00230192 predicted 1474
9 SASI_Rn02_00230193 predicted 1151
10 SASI_Rn02_00230194 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040752 predicted 1107
2 SASI_Mm01_00040753 predicted 259
3 SASI_Mm01_00040754 predicted 1426
4 SASI_Mm02_00341730 predicted 1156
5 SASI_Mm01_00040755 predicted 1145
6 SASI_Mm01_00040756 predicted 925
7 SASI_Mm01_00040757 predicted 624
8 SASI_Mm01_00040758 predicted 1236
9 SASI_Mm01_00040759 predicted 747
10 SASI_Mm01_00040761 predicted 1200
11 SASI_Mm01_00040760 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146092
TAF6L MISSION shRNA Bacterial Glycerol Stock
TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-264s21c1
Sequence:CCGGCCACACAGAATAGCTCTCAATCTCGAGATTGAGAGCTATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-926s21c1
Sequence:CCGGGCCCTTCTACTCAGTCACATACTCGAGTATGTGACTGAGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-1445s21c1
Sequence:CCGGCGTGAGCTATACTCCTTCTTTCTCGAGAAAGAAGGAGTATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-1832s21c1
Sequence:CCGGCGCCTCTTTCAAACTGCCTTTCTCGAGAAAGGCAGTTTGAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-926s1c1
Sequence:CCGGGCCCTTCTACTCAGTCACATACTCGAGTATGTGACTGAGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1114s1c1
Sequence:CCGGGCCCACTTACTGGACAAACTTCTCGAGAAGTTTGTCCAGTAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1832s1c1
Sequence:CCGGCGCCTCTTTCAAACTGCCTTTCTCGAGAAAGGCAGTTTGAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-264s1c1
Sequence:CCGGCCACACAGAATAGCTCTCAATCTCGAGATTGAGAGCTATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1445s1c1
Sequence:CCGGCGTGAGCTATACTCCTTCTTTCTCGAGAAAGAAGGAGTATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146092
TAF6L MISSION shRNA shRNA Plasmid DNA
TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-264s21c1
Sequence:CCGGCCACACAGAATAGCTCTCAATCTCGAGATTGAGAGCTATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-926s21c1
Sequence:CCGGGCCCTTCTACTCAGTCACATACTCGAGTATGTGACTGAGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-1445s21c1
Sequence:CCGGCGTGAGCTATACTCCTTCTTTCTCGAGAAAGAAGGAGTATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-1832s21c1
Sequence:CCGGCGCCTCTTTCAAACTGCCTTTCTCGAGAAAGGCAGTTTGAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-926s1c1
Sequence:CCGGGCCCTTCTACTCAGTCACATACTCGAGTATGTGACTGAGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1114s1c1
Sequence:CCGGGCCCACTTACTGGACAAACTTCTCGAGAAGTTTGTCCAGTAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1832s1c1
Sequence:CCGGCGCCTCTTTCAAACTGCCTTTCTCGAGAAAGGCAGTTTGAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-264s1c1
Sequence:CCGGCCACACAGAATAGCTCTCAATCTCGAGATTGAGAGCTATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1445s1c1
Sequence:CCGGCGTGAGCTATACTCCTTCTTTCTCGAGAAAGAAGGAGTATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146092
TAF6L MISSION shRNA Lentiviral Transduction Particles
TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-264s21c1
Sequence:CCGGCCACACAGAATAGCTCTCAATCTCGAGATTGAGAGCTATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-926s21c1
Sequence:CCGGGCCCTTCTACTCAGTCACATACTCGAGTATGTGACTGAGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-1445s21c1
Sequence:CCGGCGTGAGCTATACTCCTTCTTTCTCGAGAAAGAAGGAGTATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146092.1-1832s21c1
Sequence:CCGGCGCCTCTTTCAAACTGCCTTTCTCGAGAAAGGCAGTTTGAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-926s1c1
Sequence:CCGGGCCCTTCTACTCAGTCACATACTCGAGTATGTGACTGAGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1114s1c1
Sequence:CCGGGCCCACTTACTGGACAAACTTCTCGAGAAGTTTGTCCAGTAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1832s1c1
Sequence:CCGGCGCCTCTTTCAAACTGCCTTTCTCGAGAAAGGCAGTTTGAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-264s1c1
Sequence:CCGGCCACACAGAATAGCTCTCAATCTCGAGATTGAGAGCTATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146092.1-1445s1c1
Sequence:CCGGCGTGAGCTATACTCCTTCTTTCTCGAGAAAGAAGGAGTATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006473
TAF6L MISSION shRNA Bacterial Glycerol Stock
TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-1113s21c1
Sequence:CCGGCAGGCTGTGCTGGATGATTATCTCGAGATAATCATCCAGCACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-759s21c1
Sequence:CCGGGCACGGAGCCTATTTCGTAATCTCGAGATTACGAAATAGGCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-565s21c1
Sequence:CCGGATGACCTTCTCAAGTACTATCCTCGAGGATAGTACTTGAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-232s21c1
Sequence:CCGGTGAGAGAGGCCACGCAGAATACTCGAGTATTCTGCGTGGCCTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-1138s21c1
Sequence:CCGGTATCTAATGCCCAGGTCAAAGCTCGAGCTTTGACCTGGGCATTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-546s1c1
Sequence:CCGGGCTGTGTCTTCACTGACAGATCTCGAGATCTGTCAGTGAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-1091s1c1
Sequence:CCGGGTCCACCTACTGGACAAACTTCTCGAGAAGTTTGTCCAGTAGGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-242s1c1
Sequence:CCGGCACGCAGAATAGCTCTCAGTTCTCGAGAACTGAGAGCTATTCTGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006473
TAF6L MISSION shRNA shRNA Plasmid DNA
TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-1113s21c1
Sequence:CCGGCAGGCTGTGCTGGATGATTATCTCGAGATAATCATCCAGCACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-759s21c1
Sequence:CCGGGCACGGAGCCTATTTCGTAATCTCGAGATTACGAAATAGGCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-565s21c1
Sequence:CCGGATGACCTTCTCAAGTACTATCCTCGAGGATAGTACTTGAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-232s21c1
Sequence:CCGGTGAGAGAGGCCACGCAGAATACTCGAGTATTCTGCGTGGCCTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-1138s21c1
Sequence:CCGGTATCTAATGCCCAGGTCAAAGCTCGAGCTTTGACCTGGGCATTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-546s1c1
Sequence:CCGGGCTGTGTCTTCACTGACAGATCTCGAGATCTGTCAGTGAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-1091s1c1
Sequence:CCGGGTCCACCTACTGGACAAACTTCTCGAGAAGTTTGTCCAGTAGGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-242s1c1
Sequence:CCGGCACGCAGAATAGCTCTCAGTTCTCGAGAACTGAGAGCTATTCTGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006473
TAF6L MISSION shRNA Lentiviral Transduction Particles
TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-1113s21c1
Sequence:CCGGCAGGCTGTGCTGGATGATTATCTCGAGATAATCATCCAGCACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-759s21c1
Sequence:CCGGGCACGGAGCCTATTTCGTAATCTCGAGATTACGAAATAGGCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-565s21c1
Sequence:CCGGATGACCTTCTCAAGTACTATCCTCGAGGATAGTACTTGAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-232s21c1
Sequence:CCGGTGAGAGAGGCCACGCAGAATACTCGAGTATTCTGCGTGGCCTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006473.2-1138s21c1
Sequence:CCGGTATCTAATGCCCAGGTCAAAGCTCGAGCTTTGACCTGGGCATTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-546s1c1
Sequence:CCGGGCTGTGTCTTCACTGACAGATCTCGAGATCTGTCAGTGAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-1091s1c1
Sequence:CCGGGTCCACCTACTGGACAAACTTCTCGAGAAGTTTGTCCAGTAGGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006473.2-242s1c1
Sequence:CCGGCACGCAGAATAGCTCTCAGTTCTCGAGAACTGAGAGCTATTCTGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks