EMAIL THIS PAGE TO A FRIEND

TAF7

TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa

Synonyms: TAF2F TAFII55
UniProtKB ID: Q15545, B2RBV9, Q13036
Gene ID:
Human(6879) Summary: The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II. [provided by RefSeq, Jul 2008]
Mouse(24074) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(307485) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor
cow(509327) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
sheep(101104487) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
naked mole-rat(101706395) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
domestic guinea pig(100727334) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
fruit fly(40934) TBP-associated factor 7
domestic cat(101099682) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
dog(487180) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
chicken(422192) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Zebrafish(100002261) TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Thale Cress(841975) TBP-associated factor 7
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005642 Rosetta Predictions human pricing
NM_001107394 Rosetta Predictions rat pricing
NM_011901 Rosetta Predictions mouse pricing
NM_175770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201098 predicted 1141
2 SASI_Hs01_00201099 predicted 821
3 SASI_Hs02_00339988 predicted 1267
4 SASI_Hs01_00201100 predicted 1024
5 SASI_Hs01_00201101 predicted 1061
6 SASI_Hs01_00201102 predicted 798
7 SASI_Hs01_00201105 predicted 1260
8 SASI_Hs02_00339989 predicted 1137
9 SASI_Hs02_00339990 predicted 1852
10 SASI_Hs01_00201097 predicted 1530
11 SASI_Hs01_00201103 predicted 1563
12 SASI_Hs01_00201104 predicted 1681
13 SASI_Hs01_00201106 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228385 predicted 426
2 SASI_Rn02_00228386 predicted 741
3 SASI_Rn02_00228387 predicted 1179
4 SASI_Rn02_00228388 predicted 1078
5 SASI_Rn02_00228389 predicted 297
6 SASI_Rn02_00228390 predicted 499
7 SASI_Rn02_00228391 predicted 1204
8 SASI_Rn02_00228392 predicted 1324
9 SASI_Rn02_00228393 predicted 1347
10 SASI_Rn02_00228394 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176560 predicted 656
2 SASI_Mm02_00321711 predicted 755
3 SASI_Mm01_00176561 predicted 1019
4 SASI_Mm01_00176562 predicted 621
5 SASI_Mm01_00176563 predicted 964
6 SASI_Mm01_00176564 predicted 624
7 SASI_Mm01_00176565 predicted 754
8 SASI_Mm01_00176566 predicted 924
9 SASI_Mm02_00321712 predicted 614
10 SASI_Mm01_00176567 predicted 1021
11 SASI_Mm01_00176568 predicted 295
12 SASI_Mm01_00176569 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170183 predicted 668
2 SASI_Mm02_00346665 predicted 764
3 SASI_Mm01_00170184 predicted 1032
4 SASI_Mm01_00170185 predicted 635
5 SASI_Mm01_00170186 predicted 982
6 SASI_Mm01_00170187 predicted 640
7 SASI_Mm01_00170188 predicted 762
8 SASI_Mm01_00170189 predicted 939
9 SASI_Mm02_00346666 predicted 623
10 SASI_Mm01_00170190 predicted 1031
11 SASI_Mm01_00170191 predicted 309
12 SASI_Mm01_00170192 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005642
VALIDATED
TAF7 MISSION shRNA Bacterial Glycerol Stock
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005642.2-1985s1c1
Sequence:CCGGGCAGGATTGTATAGGCAGAAACTCGAGTTTCTGCCTATACAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005642.2-1766s1c1
Sequence:CCGGGCTAGAATCACTCCTAGAGAACTCGAGTTCTCTAGGAGTGATTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005642.2-1278s1c1
Sequence:CCGGCGGTGGGAAATAATTGCCGAACTCGAGTTCGGCAATTATTTCCCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005642.2-770s1c1
Sequence:CCGGCGAACTGGAGAGCCAGTTTATCTCGAGATAAACTGGCTCTCCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005642.2-1142s1c1
Sequence:CCGGCGGAATTACTCTGCCTCTAAACTCGAGTTTAGAGGCAGAGTAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005642.2-1985s21c1
Sequence:CCGGGCAGGATTGTATAGGCAGAAACTCGAGTTTCTGCCTATACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005642.2-1278s21c1
Sequence:CCGGCGGTGGGAAATAATTGCCGAACTCGAGTTCGGCAATTATTTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005642
VALIDATED
TAF7 MISSION shRNA shRNA Plasmid DNA
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005642.2-1985s1c1
Sequence:CCGGGCAGGATTGTATAGGCAGAAACTCGAGTTTCTGCCTATACAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005642.2-1766s1c1
Sequence:CCGGGCTAGAATCACTCCTAGAGAACTCGAGTTCTCTAGGAGTGATTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005642.2-1278s1c1
Sequence:CCGGCGGTGGGAAATAATTGCCGAACTCGAGTTCGGCAATTATTTCCCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005642.2-770s1c1
Sequence:CCGGCGAACTGGAGAGCCAGTTTATCTCGAGATAAACTGGCTCTCCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005642.2-1142s1c1
Sequence:CCGGCGGAATTACTCTGCCTCTAAACTCGAGTTTAGAGGCAGAGTAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005642.2-1985s21c1
Sequence:CCGGGCAGGATTGTATAGGCAGAAACTCGAGTTTCTGCCTATACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005642.2-1278s21c1
Sequence:CCGGCGGTGGGAAATAATTGCCGAACTCGAGTTCGGCAATTATTTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005642
VALIDATED
TAF7 MISSION shRNA Lentiviral Transduction Particles
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005642.2-1985s1c1
Sequence:CCGGGCAGGATTGTATAGGCAGAAACTCGAGTTTCTGCCTATACAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005642.2-1766s1c1
Sequence:CCGGGCTAGAATCACTCCTAGAGAACTCGAGTTCTCTAGGAGTGATTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005642.2-1278s1c1
Sequence:CCGGCGGTGGGAAATAATTGCCGAACTCGAGTTCGGCAATTATTTCCCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005642.2-770s1c1
Sequence:CCGGCGAACTGGAGAGCCAGTTTATCTCGAGATAAACTGGCTCTCCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005642.2-1142s1c1
Sequence:CCGGCGGAATTACTCTGCCTCTAAACTCGAGTTTAGAGGCAGAGTAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005642.2-1985s21c1
Sequence:CCGGGCAGGATTGTATAGGCAGAAACTCGAGTTTCTGCCTATACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005642.2-1278s21c1
Sequence:CCGGCGGTGGGAAATAATTGCCGAACTCGAGTTCGGCAATTATTTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011901
VALIDATED
TAF7 MISSION shRNA Bacterial Glycerol Stock
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011901.1-1426s1c1
Sequence:CCGGGATTACATAGACAGGTTTGTTCTCGAGAACAAACCTGTCTATGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-357s1c1
Sequence:CCGGAGCATTGAGTTACACCCTGATCTCGAGATCAGGGTGTAACTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-1254s1c1
Sequence:CCGGGCTTGTTGACTTTAGTCCTTACTCGAGTAAGGACTAAAGTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-765s1c1
Sequence:CCGGCGTTGGGAGATAATTGCTGAACTCGAGTTCAGCAATTATCTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-437s1c1
Sequence:CCGGGCCTTGTGTTACGGAAAGCTTCTCGAGAAGCTTTCCGTAACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-759s21c1
Sequence:CCGGAGTACTCGTTGGGAGATAATTCTCGAGAATTATCTCCCAACGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-874s21c1
Sequence:CCGGATGATGAGCTTCGAGAGATATCTCGAGATATCTCTCGAAGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-1103s21c1
Sequence:CCGGGCGCCAGGAAGATCTCATTATCTCGAGATAATGAGATCTTCCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011901.1-1556s21c1
Sequence:CCGGTGGTGCTAAGATCAGTAATAACTCGAGTTATTACTGATCTTAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-258s21c1
Sequence:CCGGGAGCTAGAGAGCCAGTTTATCCTCGAGGATAAACTGGCTCTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011901
VALIDATED
TAF7 MISSION shRNA shRNA Plasmid DNA
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011901.1-1426s1c1
Sequence:CCGGGATTACATAGACAGGTTTGTTCTCGAGAACAAACCTGTCTATGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-357s1c1
Sequence:CCGGAGCATTGAGTTACACCCTGATCTCGAGATCAGGGTGTAACTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-1254s1c1
Sequence:CCGGGCTTGTTGACTTTAGTCCTTACTCGAGTAAGGACTAAAGTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-765s1c1
Sequence:CCGGCGTTGGGAGATAATTGCTGAACTCGAGTTCAGCAATTATCTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-437s1c1
Sequence:CCGGGCCTTGTGTTACGGAAAGCTTCTCGAGAAGCTTTCCGTAACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-759s21c1
Sequence:CCGGAGTACTCGTTGGGAGATAATTCTCGAGAATTATCTCCCAACGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-874s21c1
Sequence:CCGGATGATGAGCTTCGAGAGATATCTCGAGATATCTCTCGAAGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-1103s21c1
Sequence:CCGGGCGCCAGGAAGATCTCATTATCTCGAGATAATGAGATCTTCCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011901.1-1556s21c1
Sequence:CCGGTGGTGCTAAGATCAGTAATAACTCGAGTTATTACTGATCTTAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-258s21c1
Sequence:CCGGGAGCTAGAGAGCCAGTTTATCCTCGAGGATAAACTGGCTCTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011901
VALIDATED
TAF7 MISSION shRNA Lentiviral Transduction Particles
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011901.1-1426s1c1
Sequence:CCGGGATTACATAGACAGGTTTGTTCTCGAGAACAAACCTGTCTATGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-357s1c1
Sequence:CCGGAGCATTGAGTTACACCCTGATCTCGAGATCAGGGTGTAACTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-1254s1c1
Sequence:CCGGGCTTGTTGACTTTAGTCCTTACTCGAGTAAGGACTAAAGTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-765s1c1
Sequence:CCGGCGTTGGGAGATAATTGCTGAACTCGAGTTCAGCAATTATCTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011901.1-437s1c1
Sequence:CCGGGCCTTGTGTTACGGAAAGCTTCTCGAGAAGCTTTCCGTAACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-759s21c1
Sequence:CCGGAGTACTCGTTGGGAGATAATTCTCGAGAATTATCTCCCAACGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-874s21c1
Sequence:CCGGATGATGAGCTTCGAGAGATATCTCGAGATATCTCTCGAAGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-1103s21c1
Sequence:CCGGGCGCCAGGAAGATCTCATTATCTCGAGATAATGAGATCTTCCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011901.1-1556s21c1
Sequence:CCGGTGGTGCTAAGATCAGTAATAACTCGAGTTATTACTGATCTTAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011901.1-258s21c1
Sequence:CCGGGAGCTAGAGAGCCAGTTTATCCTCGAGGATAAACTGGCTCTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175770
TAF7 MISSION shRNA Bacterial Glycerol Stock
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000353207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175770.4-1803s21c1
Sequence:CCGGAGGTGGTTCATGGAGTTTAATCTCGAGATTAAACTCCATGAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-971s21c1
Sequence:CCGGGAAGATGAAGAAGACGTAAACCTCGAGGTTTACGTCTTCTTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-481s21c1
Sequence:CCGGGGTCGATTTGCCTTGTGTTACCTCGAGGTAACACAAGGCAAATCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-1021s21c1
Sequence:CCGGACAGCTACAAGACAAGCTAAACTCGAGTTTAGCTTGTCTTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175770
TAF7 MISSION shRNA shRNA Plasmid DNA
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000353207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175770.4-1803s21c1
Sequence:CCGGAGGTGGTTCATGGAGTTTAATCTCGAGATTAAACTCCATGAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-971s21c1
Sequence:CCGGGAAGATGAAGAAGACGTAAACCTCGAGGTTTACGTCTTCTTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-481s21c1
Sequence:CCGGGGTCGATTTGCCTTGTGTTACCTCGAGGTAACACAAGGCAAATCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-1021s21c1
Sequence:CCGGACAGCTACAAGACAAGCTAAACTCGAGTTTAGCTTGTCTTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175770
TAF7 MISSION shRNA Lentiviral Transduction Particles
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000353207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175770.4-1803s21c1
Sequence:CCGGAGGTGGTTCATGGAGTTTAATCTCGAGATTAAACTCCATGAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-971s21c1
Sequence:CCGGGAAGATGAAGAAGACGTAAACCTCGAGGTTTACGTCTTCTTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-481s21c1
Sequence:CCGGGGTCGATTTGCCTTGTGTTACCTCGAGGTAACACAAGGCAAATCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175770.4-1021s21c1
Sequence:CCGGACAGCTACAAGACAAGCTAAACTCGAGTTTAGCTTGTCTTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks