EMAIL THIS PAGE TO A FRIEND

TAF7L

TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa

Synonyms: CT40 TAF2Q
UniProtKB ID: Q5H9L4, Q5H9L6, Q86XI4, Q9BXU5, Q9H5R0
Gene ID:
Human(54457) Summary: This gene is similar to a mouse gene that encodes a TATA box binding protein-associated factor, and shows testis-specific expression. The encoded protein could be a spermatogenesis-specific component of the DNA-binding general transcription factor complex TFIID. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(74469) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(363493) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor
dog(480985) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
domestic cat(101087562) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
domestic guinea pig(100718955) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
naked mole-rat(101716280) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
cow(615711) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
sheep(101105219) TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024885 Rosetta Predictions human pricing
XM_001068635 Rosetta Predictions rat pricing
XM_343816 Rosetta Predictions rat pricing
NM_028958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093779 predicted 352
2 SASI_Hs01_00093780 predicted 454
3 SASI_Hs01_00093781 predicted 376
4 SASI_Hs01_00093782 predicted 353
5 SASI_Hs01_00093783 predicted 360
6 SASI_Hs01_00093784 predicted 424
7 SASI_Hs02_00357478 predicted 449
8 SASI_Hs01_00093785 predicted 463
9 SASI_Hs01_00093787 predicted 363
10 SASI_Hs01_00093788 predicted 1140
11 SASI_Hs01_00093786 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325236 predicted 1442
2 SASI_Rn02_00325237 predicted 1541
3 SASI_Rn02_00325238 predicted 1695
4 SASI_Rn02_00325239 predicted 431
5 SASI_Rn02_00325240 predicted 483
6 SASI_Rn02_00325241 predicted 196
7 SASI_Rn02_00325242 predicted 357
8 SASI_Rn02_00325243 predicted 1406
9 SASI_Rn02_00325244 predicted 1576
10 SASI_Rn02_00325245 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396359 predicted 316
2 SASI_Rn02_00396360 predicted 409
3 SASI_Rn02_00396361 predicted 201
4 SASI_Rn02_00396362 predicted 342
5 SASI_Rn02_00396363 predicted 241
6 SASI_Rn02_00396364 predicted 363
7 SASI_Rn02_00396365 predicted 318
8 SASI_Rn02_00396366 predicted 412
9 SASI_Rn02_00396367 predicted 346
10 SASI_Rn02_00396368 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065088 predicted 1201
2 SASI_Mm01_00065089 predicted 403
3 SASI_Mm01_00065090 predicted 1122
4 SASI_Mm01_00065091 predicted 1145
5 SASI_Mm01_00065092 predicted 1013
6 SASI_Mm01_00065093 predicted 700
7 SASI_Mm01_00065094 predicted 1290
8 SASI_Mm01_00065095 predicted 332
9 SASI_Mm01_00065096 predicted 1003
10 SASI_Mm01_00065097 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024885
TAF7L MISSION shRNA Bacterial Glycerol Stock
TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1059s21c1
Sequence:CCGGGAGGATGAGGATGAGGATGAACTCGAGTTCATCCTCATCCTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1070s21c1
Sequence:CCGGTGAGGATGAAGATGAAGACAACTCGAGTTGTCTTCATCTTCATCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1026s21c1
Sequence:CCGGGATGATGAGGATGAGGATGATCTCGAGATCATCCTCATCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1276s21c1
Sequence:CCGGATCTCATCATGAAAGTGGAAACTCGAGTTTCCACTTTCATGATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-422s1c1
Sequence:CCGGGCAGTTGTTGAAGTAGAAGATCTCGAGATCTTCTACTTCAACAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-994s1c1
Sequence:CCGGGCTCCATAAGATTCAGAATAACTCGAGTTATTCTGAATCTTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-1054s1c1
Sequence:CCGGCCTGACACTCAAGAATCATTTCTCGAGAAATGATTCTTGAGTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-371s1c1
Sequence:CCGGGTCAAGATGAAGGATAAACTACTCGAGTAGTTTATCCTTCATCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-596s1c1
Sequence:CCGGGCCTCTACTGATCCTAATATACTCGAGTATATTAGGATCAGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024885
TAF7L MISSION shRNA shRNA Plasmid DNA
TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1059s21c1
Sequence:CCGGGAGGATGAGGATGAGGATGAACTCGAGTTCATCCTCATCCTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1070s21c1
Sequence:CCGGTGAGGATGAAGATGAAGACAACTCGAGTTGTCTTCATCTTCATCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1026s21c1
Sequence:CCGGGATGATGAGGATGAGGATGATCTCGAGATCATCCTCATCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1276s21c1
Sequence:CCGGATCTCATCATGAAAGTGGAAACTCGAGTTTCCACTTTCATGATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-422s1c1
Sequence:CCGGGCAGTTGTTGAAGTAGAAGATCTCGAGATCTTCTACTTCAACAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-994s1c1
Sequence:CCGGGCTCCATAAGATTCAGAATAACTCGAGTTATTCTGAATCTTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-1054s1c1
Sequence:CCGGCCTGACACTCAAGAATCATTTCTCGAGAAATGATTCTTGAGTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-371s1c1
Sequence:CCGGGTCAAGATGAAGGATAAACTACTCGAGTAGTTTATCCTTCATCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-596s1c1
Sequence:CCGGGCCTCTACTGATCCTAATATACTCGAGTATATTAGGATCAGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024885
TAF7L MISSION shRNA Lentiviral Transduction Particles
TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1059s21c1
Sequence:CCGGGAGGATGAGGATGAGGATGAACTCGAGTTCATCCTCATCCTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1070s21c1
Sequence:CCGGTGAGGATGAAGATGAAGACAACTCGAGTTGTCTTCATCTTCATCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1026s21c1
Sequence:CCGGGATGATGAGGATGAGGATGATCTCGAGATCATCCTCATCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024885.3-1276s21c1
Sequence:CCGGATCTCATCATGAAAGTGGAAACTCGAGTTTCCACTTTCATGATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-422s1c1
Sequence:CCGGGCAGTTGTTGAAGTAGAAGATCTCGAGATCTTCTACTTCAACAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-994s1c1
Sequence:CCGGGCTCCATAAGATTCAGAATAACTCGAGTTATTCTGAATCTTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-1054s1c1
Sequence:CCGGCCTGACACTCAAGAATCATTTCTCGAGAAATGATTCTTGAGTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-371s1c1
Sequence:CCGGGTCAAGATGAAGGATAAACTACTCGAGTAGTTTATCCTTCATCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024885.1-596s1c1
Sequence:CCGGGCCTCTACTGATCCTAATATACTCGAGTATATTAGGATCAGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028958
TAF7L MISSION shRNA Bacterial Glycerol Stock
TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028958.2-1520s1c1
Sequence:CCGGGCCGTCCTTGTCAAAGGTTTACTCGAGTAAACCTTTGACAAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-770s1c1
Sequence:CCGGGCTAGTTTATCAGACTATGATCTCGAGATCATAGTCTGATAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-299s1c1
Sequence:CCGGCTGGTTAATCTGCCTTGTGTTCTCGAGAACACAAGGCAGATTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-133s1c1
Sequence:CCGGCGTTGAGGAACAGTTTATATTCTCGAGAATATAAACTGTTCCTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-1201s1c1
Sequence:CCGGCCAGGAACAACTGAAATGTTTCTCGAGAAACATTTCAGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028958
TAF7L MISSION shRNA shRNA Plasmid DNA
TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028958.2-1520s1c1
Sequence:CCGGGCCGTCCTTGTCAAAGGTTTACTCGAGTAAACCTTTGACAAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-770s1c1
Sequence:CCGGGCTAGTTTATCAGACTATGATCTCGAGATCATAGTCTGATAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-299s1c1
Sequence:CCGGCTGGTTAATCTGCCTTGTGTTCTCGAGAACACAAGGCAGATTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-133s1c1
Sequence:CCGGCGTTGAGGAACAGTTTATATTCTCGAGAATATAAACTGTTCCTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-1201s1c1
Sequence:CCGGCCAGGAACAACTGAAATGTTTCTCGAGAAACATTTCAGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028958
TAF7L MISSION shRNA Lentiviral Transduction Particles
TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028958.2-1520s1c1
Sequence:CCGGGCCGTCCTTGTCAAAGGTTTACTCGAGTAAACCTTTGACAAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-770s1c1
Sequence:CCGGGCTAGTTTATCAGACTATGATCTCGAGATCATAGTCTGATAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-299s1c1
Sequence:CCGGCTGGTTAATCTGCCTTGTGTTCTCGAGAACACAAGGCAGATTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-133s1c1
Sequence:CCGGCGTTGAGGAACAGTTTATATTCTCGAGAATATAAACTGTTCCTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028958.2-1201s1c1
Sequence:CCGGCCAGGAACAACTGAAATGTTTCTCGAGAAACATTTCAGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks