EMAIL THIS PAGE TO A FRIEND

TAF8

TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa

Synonyms: 43 II TAF TAFII-43 TAFII43 TBN
UniProtKB ID: Q7Z7C8, Q5T0K1, Q8N4R9, Q96M52
Gene ID:
Human(129685) Summary: This gene encodes one of several TATA-binding protein (TBP)-associated factors (TAFs), which are integral subunits of the general transcription factor complex TFIID. TFIID recognizes the core promoter of many genes and nucleates the assembly of a transcription preinitiation complex containing RNA polymerase II and other initiation factors. The protein encoded by this gene contains an H4-like histone fold domain, and interacts with several subunits of TFIID including TBP and the histone-fold protein TAF10. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(63856) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factorq
Rat(316216) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor
domestic guinea pig(100715432) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
naked mole-rat(101707454) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
cow(539938) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
sheep(101109836) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
fruit fly(32792) TBP-associated factor 8
chicken(419929) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
domestic cat(101101564) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
dog(481798) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Zebrafish(393256) TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Thale Cress(829584) TBP-associated factor 8
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138572 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138572 Rosetta Predictions human pricing
NM_001108197 Rosetta Predictions rat pricing
NM_022015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245233 predicted 358
2 SASI_Hs01_00245235 predicted 291
3 SASI_Hs01_00245236 predicted 210
4 SASI_Hs02_00363717 predicted 875
5 SASI_Hs02_00363718 predicted 294
6 SASI_Hs01_00245239 predicted 578
7 SASI_Hs01_00245240 predicted 230
8 SASI_Hs02_00363719 predicted 310
9 SASI_Hs02_00363720 predicted 601
10 SASI_Hs02_00363721 predicted 778
11 SASI_Hs01_00245232 predicted 221
12 SASI_Hs01_00245234 predicted 306
13 SASI_Hs01_00245237 predicted 1262
14 SASI_Hs01_00245238 predicted 1283
15 SASI_Hs01_00245241 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236274 predicted 1279
2 SASI_Rn02_00236275 predicted 1330
3 SASI_Rn02_00236276 predicted 1055
4 SASI_Rn02_00236277 predicted 343
5 SASI_Rn02_00236278 predicted 760
6 SASI_Rn02_00236279 predicted 1397
7 SASI_Rn02_00236280 predicted 534
8 SASI_Rn02_00236281 predicted 223
9 SASI_Rn02_00236282 predicted 1080
10 SASI_Rn02_00236283 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080561 predicted 763
2 SASI_Mm01_00080562 predicted 217
3 SASI_Mm01_00080563 predicted 1100
4 SASI_Mm01_00080564 predicted 308
5 SASI_Mm01_00080565 predicted 1386
6 SASI_Mm02_00326488 predicted 771
7 SASI_Mm01_00080567 predicted 946
8 SASI_Mm01_00080568 predicted 301
9 SASI_Mm01_00080569 predicted 1379
10 SASI_Mm01_00080570 predicted 702
11 SASI_Mm01_00080566 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138572
VALIDATED
TAF8 MISSION shRNA Bacterial Glycerol Stock
TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-581s1c1
Sequence:CCGGGCGGGCACTTACCCGTTTCATCTCGAGATGAAACGGGTAAGTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-770s1c1
Sequence:CCGGACAGAGAACCTTGCTCTTCATCTCGAGATGAAGAGCAAGGTTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138572.1-216s1c1
Sequence:CCGGCAGAGCTACATTTCAGAAATTCTCGAGAATTTCTGAAATGTAGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-641s1c1
Sequence:CCGGCGTCAGCACATTTCCATTGATCTCGAGATCAATGGAAATGTGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138572.1-59s1c1
Sequence:CCGGCGGAACGAGATCGGGAAGTAACTCGAGTTACTTCCCGATCTCGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-719s21c1
Sequence:CCGGTGAACTGGAGATGCAACAAATCTCGAGATTTGTTGCATCTCCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-892s21c1
Sequence:CCGGACATCATCGATAACCCTTATCCTCGAGGATAAGGGTTATCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-782s21c1
Sequence:GTACCGGAGAGAACCTTGCTCTTCATATCTCGAGATATGAAGAGCAAGGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138572.2-2929s21c1
Sequence:CCGGGAATCCTAACGTCCATATTTACTCGAGTAAATATGGACGTTAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-97s21c1
Sequence:CCGGCTAACCCTGCCGATAACTATCCTCGAGGATAGTTATCGGCAGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138572
VALIDATED
TAF8 MISSION shRNA shRNA Plasmid DNA
TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-581s1c1
Sequence:CCGGGCGGGCACTTACCCGTTTCATCTCGAGATGAAACGGGTAAGTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-770s1c1
Sequence:CCGGACAGAGAACCTTGCTCTTCATCTCGAGATGAAGAGCAAGGTTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138572.1-216s1c1
Sequence:CCGGCAGAGCTACATTTCAGAAATTCTCGAGAATTTCTGAAATGTAGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-641s1c1
Sequence:CCGGCGTCAGCACATTTCCATTGATCTCGAGATCAATGGAAATGTGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138572.1-59s1c1
Sequence:CCGGCGGAACGAGATCGGGAAGTAACTCGAGTTACTTCCCGATCTCGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-719s21c1
Sequence:CCGGTGAACTGGAGATGCAACAAATCTCGAGATTTGTTGCATCTCCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-892s21c1
Sequence:CCGGACATCATCGATAACCCTTATCCTCGAGGATAAGGGTTATCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-782s21c1
Sequence:GTACCGGAGAGAACCTTGCTCTTCATATCTCGAGATATGAAGAGCAAGGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138572.2-2929s21c1
Sequence:CCGGGAATCCTAACGTCCATATTTACTCGAGTAAATATGGACGTTAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-97s21c1
Sequence:CCGGCTAACCCTGCCGATAACTATCCTCGAGGATAGTTATCGGCAGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138572
VALIDATED
TAF8 MISSION shRNA Lentiviral Transduction Particles
TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-581s1c1
Sequence:CCGGGCGGGCACTTACCCGTTTCATCTCGAGATGAAACGGGTAAGTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-770s1c1
Sequence:CCGGACAGAGAACCTTGCTCTTCATCTCGAGATGAAGAGCAAGGTTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138572.1-216s1c1
Sequence:CCGGCAGAGCTACATTTCAGAAATTCTCGAGAATTTCTGAAATGTAGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138572.1-641s1c1
Sequence:CCGGCGTCAGCACATTTCCATTGATCTCGAGATCAATGGAAATGTGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138572.1-59s1c1
Sequence:CCGGCGGAACGAGATCGGGAAGTAACTCGAGTTACTTCCCGATCTCGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-719s21c1
Sequence:CCGGTGAACTGGAGATGCAACAAATCTCGAGATTTGTTGCATCTCCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-892s21c1
Sequence:CCGGACATCATCGATAACCCTTATCCTCGAGGATAAGGGTTATCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-782s21c1
Sequence:GTACCGGAGAGAACCTTGCTCTTCATATCTCGAGATATGAAGAGCAAGGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138572.2-2929s21c1
Sequence:CCGGGAATCCTAACGTCCATATTTACTCGAGTAAATATGGACGTTAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138572.2-97s21c1
Sequence:CCGGCTAACCCTGCCGATAACTATCCTCGAGGATAGTTATCGGCAGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022015
VALIDATED
TAF8 MISSION shRNA Bacterial Glycerol Stock
TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022015.2-292s1c1
Sequence:CCGGCGTGGTCACATTGGTTGAAATCTCGAGATTTCAACCAATGTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-707s1c1
Sequence:CCGGCTGGAGATACAGCAGATGGAACTCGAGTTCCATCTGCTGTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022015.2-2558s1c1
Sequence:CCGGGCCTCTCAAATGGTAGGCAATCTCGAGATTGCCTACCATTTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-208s1c1
Sequence:CCGGGCAGAGCTACATCTCAGAAATCTCGAGATTTCTGAGATGTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-761s1c1
Sequence:CCGGGATACAGAGAACAACGCTCTTCTCGAGAAGAGCGTTGTTCTCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-142s21c1
Sequence:CCGGTTGCTGACAGAGGCGGGATTTCTCGAGAAATCCCGCCTCTGTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-207s21c1
Sequence:CCGGGCAGAGCTACATCTCAGAAATCTCGAGATTTCTGAGATGTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-867s21c1
Sequence:CCGGCGAGGAGAGCGTCATCGATAACTCGAGTTATCGATGACGCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022015.3-1305s21c1
Sequence:CCGGGGATCCCTCTCGCTGATATAACTCGAGTTATATCAGCGAGAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-765s21c1
Sequence:CCGGAGAGAACAACGCTCTTCATATCTCGAGATATGAAGAGCGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022015
VALIDATED
TAF8 MISSION shRNA shRNA Plasmid DNA
TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022015.2-292s1c1
Sequence:CCGGCGTGGTCACATTGGTTGAAATCTCGAGATTTCAACCAATGTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-707s1c1
Sequence:CCGGCTGGAGATACAGCAGATGGAACTCGAGTTCCATCTGCTGTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022015.2-2558s1c1
Sequence:CCGGGCCTCTCAAATGGTAGGCAATCTCGAGATTGCCTACCATTTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-208s1c1
Sequence:CCGGGCAGAGCTACATCTCAGAAATCTCGAGATTTCTGAGATGTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-761s1c1
Sequence:CCGGGATACAGAGAACAACGCTCTTCTCGAGAAGAGCGTTGTTCTCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-142s21c1
Sequence:CCGGTTGCTGACAGAGGCGGGATTTCTCGAGAAATCCCGCCTCTGTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-207s21c1
Sequence:CCGGGCAGAGCTACATCTCAGAAATCTCGAGATTTCTGAGATGTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-867s21c1
Sequence:CCGGCGAGGAGAGCGTCATCGATAACTCGAGTTATCGATGACGCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022015.3-1305s21c1
Sequence:CCGGGGATCCCTCTCGCTGATATAACTCGAGTTATATCAGCGAGAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-765s21c1
Sequence:CCGGAGAGAACAACGCTCTTCATATCTCGAGATATGAAGAGCGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022015
VALIDATED
TAF8 MISSION shRNA Lentiviral Transduction Particles
TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022015.2-292s1c1
Sequence:CCGGCGTGGTCACATTGGTTGAAATCTCGAGATTTCAACCAATGTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-707s1c1
Sequence:CCGGCTGGAGATACAGCAGATGGAACTCGAGTTCCATCTGCTGTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022015.2-2558s1c1
Sequence:CCGGGCCTCTCAAATGGTAGGCAATCTCGAGATTGCCTACCATTTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-208s1c1
Sequence:CCGGGCAGAGCTACATCTCAGAAATCTCGAGATTTCTGAGATGTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022015.2-761s1c1
Sequence:CCGGGATACAGAGAACAACGCTCTTCTCGAGAAGAGCGTTGTTCTCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-142s21c1
Sequence:CCGGTTGCTGACAGAGGCGGGATTTCTCGAGAAATCCCGCCTCTGTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-207s21c1
Sequence:CCGGGCAGAGCTACATCTCAGAAATCTCGAGATTTCTGAGATGTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-867s21c1
Sequence:CCGGCGAGGAGAGCGTCATCGATAACTCGAGTTATCGATGACGCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022015.3-1305s21c1
Sequence:CCGGGGATCCCTCTCGCTGATATAACTCGAGTTATATCAGCGAGAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022015.3-765s21c1
Sequence:CCGGAGAGAACAACGCTCTTCATATCTCGAGATATGAAGAGCGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks